21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C

Position:

• chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1 PS1_Moderate PM2 PP5_Moderate

The ENST00000291582.6(AIRE):​c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: AIRE ENST00000291582.6 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.05

Genes affected

AIRE (HGNC:360): (autoimmune regulator) This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

AIRE (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 177 pathogenic variants in the truncated region.
• PS1: Another start lost variant in ENST00000291582.6 (AIRE) was described as [Pathogenic] in ClinVar as 3314
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is Pathogenic according to our data. Variant chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is described in ClinVar as [Pathogenic]. Clinvar id is 954404.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AIRE	NM_000383.4	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG	p.Met1fs	frameshift_variant, start_lost	1/14	ENST00000291582.6	NP_000374.1
AIRE	NM_000383.4	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		5_prime_UTR_variant	1/14	ENST00000291582.6	NP_000374.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AIRE	ENST00000291582.6	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG	p.Met1fs	frameshift_variant, start_lost	1/14	1	NM_000383.4	ENSP00000291582.5
AIRE	ENST00000291582	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		5_prime_UTR_variant	1/14	1	NM_000383.4	ENSP00000291582.5
AIRE	ENST00000527919.5	n.145_188delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		non_coding_transcript_exon_variant	1/14	2
AIRE	ENST00000530812.5	n.153_196delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		non_coding_transcript_exon_variant	1/12	2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Polyglandular autoimmune syndrome, type 1 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 22, 2019

This sequence change affects the initiator methionine of the AIRE mRNA. The next in-frame methionine is located at codon 184. For these reasons, this variant has been classified as Pathogenic. Disruption of the initiator codon has been observed in several individuals affected with autoimmune polyendocrinopathy syndrome (PMID: 28911151, 20407228, 19758376, 28446514). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2040477031; hg19: chr21-45705868;