5-140114148-AGGCGGCGGCGGCGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCGAGCAGGGTGGTGCGGCGCTGGGTTCGGGCGGCTCCCTGGGGCACCCCGGCTCGGGCTCAGGCTCCGGCGGGGGCGGTGGTGGCGGCGGGGGCGGCGGCGGCAGT-A
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PS1_ModeratePP5_Moderate
The NM_005859.5(PURA):c.-20_142del(p.Met1_Gly48del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position has been classified as Pathogenic.
Frequency
Consequence
NM_005859.5 start_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005859.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PURA | TSL:6 MANE Select | c.-20_142del | p.Met1_Gly48del | start_lost conservative_inframe_deletion | Exon 1 of 1 | ENSP00000332706.3 | Q00577 | ||
| PURA | TSL:6 MANE Select | c.-20_142del | 5_prime_UTR | Exon 1 of 1 | ENSP00000332706.3 | Q00577 | |||
| PURA | c.-20_142del | p.Met1_Gly48del | start_lost conservative_inframe_deletion | Exon 2 of 2 | ENSP00000499133.1 | Q00577 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at