1-17053977-C-CCGGCAACCGGCGCCTCAAGGAGAGGG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_003000.3(SDHB):c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG(p.Ala15ProfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P14P) has been classified as Likely benign.
Frequency
Consequence
NM_003000.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- Carney-Stratakis syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Orphanet
- gastrointestinal stromal tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- pheochromocytomaInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- pheochromocytoma/paraganglioma syndrome 4Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- mitochondrial diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- renal cell carcinomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- mitochondrial complex 2 deficiency, nuclear type 4Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Cowden diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- mitochondrial complex II deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SDHB | NM_003000.3 | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift_variant, stop_gained | Exon 1 of 8 | ENST00000375499.8 | NP_002991.2 | |
| SDHB | NM_001407361.1 | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift_variant, stop_gained | Exon 1 of 8 | NP_001394290.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:1
​The c.17_42dup26 pathogenic mutation, located in coding exon 1 of the SDHB gene, results from a duplication of 26 nucleotides at positions 17 to 42, causing a translational frameshift with a predicted alternate stop codon. This mutation was identified in a cohort of patients with non-syndromic PCCs and/or PGLs (Jafri, M et al. Clin Endocrinol (Oxf). 2013 Jun;78(6):898-906). In addition to the clinical data presented in the literature, since frameshifts are typically deleterious in nature, this alteration is interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med. 2008;10:294). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at