rs1553179337
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_003000.3(SDHB):c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG(p.Ala15ProfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P14P) has been classified as Likely benign.
Frequency
Consequence
NM_003000.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- Carney-Stratakis syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Orphanet
- gastrointestinal stromal tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- pheochromocytomaInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- pheochromocytoma/paraganglioma syndrome 4Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- mitochondrial diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- renal cell carcinomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- mitochondrial complex 2 deficiency, nuclear type 4Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Cowden diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- mitochondrial complex II deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003000.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SDHB | MANE Select | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift stop_gained | Exon 1 of 8 | NP_002991.2 | P21912 | ||
| SDHB | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift stop_gained | Exon 1 of 8 | NP_001394290.1 | A0AAQ5BHD9 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SDHB | TSL:1 MANE Select | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift stop_gained | Exon 1 of 8 | ENSP00000364649.3 | P21912 | ||
| SDHB | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift stop_gained | Exon 1 of 9 | ENSP00000519325.1 | A0AAQ5BHC9 | |||
| SDHB | c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG | p.Ala15ProfsTer4 | frameshift stop_gained | Exon 1 of 8 | ENSP00000595680.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.