chr1-17053977-C-CCGGCAACCGGCGCCTCAAGGAGAGGG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_003000.3(SDHB):​c.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG​(p.Ala15fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P14P) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 31)

Consequence

SDHB
NM_003000.3 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: -0.115
Variant links:
Genes affected
SDHB (HGNC:10681): (succinate dehydrogenase complex iron sulfur subunit B) This tumor suppressor gene encodes the iron-sulfur protein subunit of the succinate dehydrogenase (SDH) enzyme complex which plays a critical role in mitochondria. The SDH enzyme complex is composed of four nuclear-encoded subunits. This enzyme complex converts succinate to fumarate which releases electrons as part of the citric acid cycle, and the enzyme complex additionally provides an attachment site for released electrons to be transferred to the oxidative phosphorylation pathway. The SDH enzyme complex plays a role in oxygen-related gene regulation through its conversion of succinate, which is an oxygen sensor that stabilizes the hypoxia-inducible factor 1 (HIF1) transcription factor. Sporadic and familial mutations in this gene result in paragangliomas, pheochromocytoma, and gastrointestinal stromal tumors, supporting a link between mitochondrial dysfunction and tumorigenesis. Mutations in this gene are also implicated in nuclear type 4 mitochondrial complex II deficiency. [provided by RefSeq, Jun 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 297 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 1-17053977-C-CCGGCAACCGGCGCCTCAAGGAGAGGG is Pathogenic according to our data. Variant chr1-17053977-C-CCGGCAACCGGCGCCTCAAGGAGAGGG is described in ClinVar as [Pathogenic]. Clinvar id is 428926.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
SDHBNM_003000.3 linkuse as main transcriptc.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG p.Ala15fs frameshift_variant, stop_gained 1/8 ENST00000375499.8 NP_002991.2 P21912
SDHBNM_001407361.1 linkuse as main transcriptc.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG p.Ala15fs frameshift_variant, stop_gained 1/8 NP_001394290.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
SDHBENST00000375499.8 linkuse as main transcriptc.17_42dupCCCTCTCCTTGAGGCGCCGGTTGCCG p.Ala15fs frameshift_variant, stop_gained 1/81 NM_003000.3 ENSP00000364649.3 P21912
SDHBENST00000466613.2 linkuse as main transcriptn.29_54dupCCCTCTCCTTGAGGCGCCGGTTGCCG non_coding_transcript_exon_variant 1/32
SDHBENST00000485515.5 linkuse as main transcriptn.5_30dupCCCTCTCCTTGAGGCGCCGGTTGCCG non_coding_transcript_exon_variant 1/75 ENSP00000519322.1

Frequencies

GnomAD3 genomes
Cov.:
31
GnomAD4 exome
Cov.:
30
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsMar 10, 2014​The c.17_42dup26 pathogenic mutation, located in coding exon 1 of the SDHB gene, results from a duplication of 26 nucleotides at positions 17 to 42, causing a translational frameshift with a predicted alternate stop codon. This mutation was identified in a cohort of patients with non-syndromic PCCs and/or PGLs (Jafri, M et al. Clin Endocrinol (Oxf). 2013 Jun;78(6):898-906). In addition to the clinical data presented in the literature, since frameshifts are typically deleterious in nature, this alteration is interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med. 2008;10:294). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553179337; hg19: chr1-17380472; API