1-34761300-TACTCCACAGTGCTGAGCCGCATCTGGCTGTCTGTGGTGTTCATCTTTCGTGTGCTGGTGTACGTGGTGGCAGCGGAGGAGGTGTGGGACGATGAGCAGAAGG-T
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_153212.3(GJB4):c.50_151del(p.Ser17_Asp50del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,214 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_153212.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
GJB4 | NM_153212.3 | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | ENST00000339480.3 | NP_694944.1 | |
GJB4 | XM_011540679.3 | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | XP_011538981.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
GJB4 | ENST00000339480.3 | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | 2 | NM_153212.3 | ENSP00000345868.1 | ||
SMIM12 | ENST00000426886.1 | n.208-42993_208-42892del | intron_variant | Intron 2 of 4 | 1 | ENSP00000429902.1 | ||||
ENSG00000255811 | ENST00000542839.1 | n.*24_*125del | downstream_gene_variant | 5 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000199 AC: 5AN: 251392Hom.: 0 AF XY: 0.0000221 AC XY: 3AN XY: 135870
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000506 AC: 74AN: 1461860Hom.: 0 AF XY: 0.0000426 AC XY: 31AN XY: 727232
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74352
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant has not been reported in the literature in individuals affected with GJB4-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant is present in population databases (no rsID available, gnomAD 0.003%). This variant, c.50_151del, results in the deletion of 34 amino acid(s) of the GJB4 protein (p.Ser17_Asp50del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at