chr1-34761300-TACTCCACAGTGCTGAGCCGCATCTGGCTGTCTGTGGTGTTCATCTTTCGTGTGCTGGTGTACGTGGTGGCAGCGGAGGAGGTGTGGGACGATGAGCAGAAGG-T
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_153212.3(GJB4):c.50_151del(p.Ser17_Asp50del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,214 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_153212.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_153212.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GJB4 | NM_153212.3 | MANE Select | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | NP_694944.1 | Q9NTQ9 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GJB4 | ENST00000339480.3 | TSL:2 MANE Select | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | ENSP00000345868.1 | Q9NTQ9 | |
| SMIM12 | ENST00000426886.1 | TSL:1 | n.208-42993_208-42892del | intron | N/A | ENSP00000429902.1 | E5RH51 | ||
| GJB4 | ENST00000919353.1 | c.50_151del | p.Ser17_Asp50del | disruptive_inframe_deletion | Exon 2 of 2 | ENSP00000589412.1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000199 AC: 5AN: 251392 AF XY: 0.0000221 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000506 AC: 74AN: 1461860Hom.: 0 AF XY: 0.0000426 AC XY: 31AN XY: 727232 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74352 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at