1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG

Position:

• chr1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_000642.3(AGL):​c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG​(p.Arg322fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R322R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: AGL NM_000642.3 frameshift, stop_gained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.361

Genes affected

AGL (HGNC:321): (amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase) This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

AGL (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AGL	NM_000642.3	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift_variant, stop_gained	8/34	ENST00000361915.8	NP_000633.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AGL	ENST00000361915.8	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift_variant, stop_gained	8/34	1	NM_000642.3	ENSP00000355106.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 19

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Glycogen storage disease type III Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 12, 2017

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies have not been reported for this variant. If the canonical splice site is maintained and the duplicated sequence is translated, then this variant is expected to result in an absent or disrupted AGL protein product. However, if the canonical splice site is not used, alternative splicing using the newly created splice site would likely have no effect on the translated protein. This variant has not been reported in the literature in individuals with AGL-related disease. This sequence change duplicates the last 72 nucleotides of intron 7 and the first 7 nucleotides of exon 8 of the AGL mRNA (c.959-72_965dup).  It is expected to either cause a frameshift at codon 322, followed by a premature translational stop signal (p.Arg322Serfs*2), or to have no protein effect due to utilization of a newly created alternate splice site. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553185268; hg19: chr1-100340170;