10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP6
The NM_007078.3(LDB3):c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC(p.Ser448_Pro449insProAlaProAlaTyrThrProSer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000108 in 1,458,694 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. S448S) has been classified as Likely benign.
Frequency
Consequence
NM_007078.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- dilated cardiomyopathyInheritance: AD, AR Classification: STRONG, LIMITED Submitted by: ClinGen
- myofibrillar myopathy 4Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial dilated cardiomyopathyInheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007078.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDB3 | NM_007078.3 | MANE Select | c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser448_Pro449insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 10 of 14 | NP_009009.1 | O75112-1 | |
| LDB3 | NM_001171610.2 | c.1335_1358dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser453_Pro454insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 10 of 14 | NP_001165081.1 | O75112-7 | ||
| LDB3 | NM_001368066.1 | c.1179_1202dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser401_Pro402insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 11 of 15 | NP_001354995.1 | A0A8I5KV04 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDB3 | ENST00000361373.9 | TSL:1 MANE Select | c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser448_Pro449insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 10 of 14 | ENSP00000355296.3 | O75112-1 | |
| LDB3 | ENST00000945680.1 | c.1524_1547dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser516_Pro517insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 10 of 14 | ENSP00000615739.1 | |||
| LDB3 | ENST00000871464.1 | c.1461_1484dupCCCTGCCCCTGCCTACACCCCCTC | p.Ser495_Pro496insProAlaProAlaTyrThrProSer | disruptive_inframe_insertion | Exon 11 of 15 | ENSP00000541523.1 |
Frequencies
GnomAD3 genomes AF: 0.0000534 AC: 8AN: 149880Hom.: 0 Cov.: 30 show subpopulations
GnomAD2 exomes AF: 0.000110 AC: 27AN: 244960 AF XY: 0.0000901 show subpopulations
GnomAD4 exome AF: 0.000108 AC: 157AN: 1458694Hom.: 0 Cov.: 33 AF XY: 0.000113 AC XY: 82AN XY: 725592 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000533 AC: 8AN: 149988Hom.: 0 Cov.: 30 AF XY: 0.0000547 AC XY: 4AN XY: 73174 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at