chr10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP6

The NM_007078.3(LDB3):​c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC​(p.Ser448_Pro449insProAlaProAlaTyrThrProSer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000108 in 1,458,694 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. S448S) has been classified as Likely benign.

Frequency

Genomes: 𝑓 0.000053 ( 0 hom., cov: 30)
Exomes 𝑓: 0.00011 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

LDB3
NM_007078.3 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2B:1

Conservation

PhyloP100: 1.95

Publications

0 publications found
Variant links:
Genes affected
LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
LDB3 Gene-Disease associations (from GenCC):
  • myofibrillar myopathy 4
    Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
  • familial isolated dilated cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • dilated cardiomyopathy
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • familial dilated cardiomyopathy
    Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
  • arrhythmogenic right ventricular cardiomyopathy
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_007078.3.
BP6
Variant 10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG is Benign according to our data. Variant chr10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 45515.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LDB3NM_007078.3 linkc.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC p.Ser448_Pro449insProAlaProAlaTyrThrProSer disruptive_inframe_insertion Exon 10 of 14 ENST00000361373.9 NP_009009.1 O75112-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LDB3ENST00000361373.9 linkc.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC p.Ser448_Pro449insProAlaProAlaTyrThrProSer disruptive_inframe_insertion Exon 10 of 14 1 NM_007078.3 ENSP00000355296.3 O75112-1

Frequencies

GnomAD3 genomes
AF:
0.0000534
AC:
8
AN:
149880
Hom.:
0
Cov.:
30
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.000133
Gnomad ASJ
AF:
0.00175
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD2 exomes
AF:
0.000110
AC:
27
AN:
244960
AF XY:
0.0000901
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.0000876
Gnomad ASJ exome
AF:
0.000906
Gnomad EAS exome
AF:
0.00
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.000101
Gnomad OTH exome
AF:
0.000166
GnomAD4 exome
AF:
0.000108
AC:
157
AN:
1458694
Hom.:
0
Cov.:
33
AF XY:
0.000113
AC XY:
82
AN XY:
725592
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.0000300
AC:
1
AN:
33376
American (AMR)
AF:
0.000134
AC:
6
AN:
44648
Ashkenazi Jewish (ASJ)
AF:
0.00288
AC:
75
AN:
26068
East Asian (EAS)
AF:
0.00
AC:
0
AN:
39682
South Asian (SAS)
AF:
0.000302
AC:
26
AN:
86042
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
53150
Middle Eastern (MID)
AF:
0.000484
AC:
2
AN:
4132
European-Non Finnish (NFE)
AF:
0.0000288
AC:
32
AN:
1111414
Other (OTH)
AF:
0.000249
AC:
15
AN:
60182
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.380
Heterozygous variant carriers
0
6
12
19
25
31
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000533
AC:
8
AN:
149988
Hom.:
0
Cov.:
30
AF XY:
0.0000547
AC XY:
4
AN XY:
73174
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
40664
American (AMR)
AF:
0.000133
AC:
2
AN:
15042
Ashkenazi Jewish (ASJ)
AF:
0.00175
AC:
6
AN:
3432
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5062
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4626
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10468
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
294
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
67418
Other (OTH)
AF:
0.00
AC:
0
AN:
2078
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.450
Heterozygous variant carriers
0
1
1
2
2
3
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
Alfa
AF:
0.000144
Hom.:
0

ClinVar

Significance: Conflicting classifications of pathogenicity
Submissions summary: Uncertain:2Benign:1
Revision: criteria provided, conflicting classifications
LINK: link

Submissions by phenotype

not specified Uncertain:1
Sep 09, 2008
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Myofibrillar myopathy 4 Uncertain:1
Dec 30, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The LDB3 gene has multiple clinically relevant transcripts. This variant occurs in alternate transcript NM_007078.3, and corresponds to NM_001080116.1:c.*17041_*17064dup in the primary transcript. This variant, c.1320_1343dup, results in the insertion of 8 amino acid(s) of the LDB3 protein (p.Ala442_Pro449dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with dilated cardiomyopathy (PMID: 27532257). ClinVar contains an entry for this variant (Variation ID: 45515). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Benign:1
Jan 22, 2021
GeneDx
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Identified independently and in conjunction with additional variants in individuals referred for cardiac genetic testing at GeneDx; segregation data is limited or absent at this time; In-frame duplication of 8 amino acids -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.0
Mutation Taster
=71/29
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134; API