NM_007078.3:c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC

Variant names:

• chr10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG
• rs397517209
• NM_007078.3:c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP6

The NM_007078.3(LDB3):​c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC​(p.Ser448_Pro449insProAlaProAlaTyrThrProSer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000108 in 1,458,694 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. S448S) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000053 (0 hom., cov: 30)
  • Exomes 𝑓: 0.00011 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: LDB3 NM_007078.3 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 1.95
• Publications: 0 publications found

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

LDB3 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD, AR Classification: STRONG, LIMITED Submitted by: ClinGen
• myofibrillar myopathy 4

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial dilated cardiomyopathy

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.
• BP6: Variant 10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG is Benign according to our data. Variant chr10-86716377-C-CCCTACACCCCCTCCCCTGCCCCTG is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 45515.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007078.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	NM_007078.3	MANE Select	c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser448_Pro449insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	NP_009009.1	O75112-1
	LDB3	NM_001171610.2		c.1335_1358dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser453_Pro454insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	NP_001165081.1	O75112-7
	LDB3	NM_001368066.1		c.1179_1202dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser401_Pro402insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 11 of 15	NP_001354995.1	A0A8I5KV04

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	ENST00000361373.9	TSL:1 MANE Select	c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser448_Pro449insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	ENSP00000355296.3	O75112-1
	LDB3	ENST00000945680.1		c.1524_1547dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser516_Pro517insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	ENSP00000615739.1
	LDB3	ENST00000871464.1		c.1461_1484dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser495_Pro496insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 11 of 15	ENSP00000541523.1

Frequencies

GnomAD3 genomes AF: 0.0000534 AC: 8 AN: 149880 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000133

Gnomad ASJ AF: 0.00175

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000110 AC: 27 AN: 244960 AF XY: 0.0000901

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000876

Gnomad ASJ exome AF: 0.000906

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000101

Gnomad OTH exome AF: 0.000166

GnomAD4 exome AF: 0.000108 AC: 157 AN: 1458694 Hom.: 0 Cov.: 33 AF XY: 0.000113 AC XY: 82 AN XY: 725592

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000300 AC: 1 AN: 33376

American (AMR) AF: 0.000134 AC: 6 AN: 44648

Ashkenazi Jewish (ASJ) AF: 0.00288 AC: 75 AN: 26068

East Asian (EAS) AF: 0.00 AC: 0 AN: 39682

South Asian (SAS) AF: 0.000302 AC: 26 AN: 86042

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53150

Middle Eastern (MID) AF: 0.000484 AC: 2 AN: 4132

European-Non Finnish (NFE) AF: 0.0000288 AC: 32 AN: 1111414

Other (OTH) AF: 0.000249 AC: 15 AN: 60182

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000533 AC: 8 AN: 149988 Hom.: 0 Cov.: 30 AF XY: 0.0000547 AC XY: 4 AN XY: 73174

African (AFR) AF: 0.00 AC: 0 AN: 40664

American (AMR) AF: 0.000133 AC: 2 AN: 15042

Ashkenazi Jewish (ASJ) AF: 0.00175 AC: 6 AN: 3432

East Asian (EAS) AF: 0.00 AC: 0 AN: 5062

South Asian (SAS) AF: 0.00 AC: 0 AN: 4626

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10468

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67418

Other (OTH) AF: 0.00 AC: 0 AN: 2078

Alfa AF: 0.000144 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Myofibrillar myopathy 4 (1)
-	-	1	not provided (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=71/29	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134;