10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-CCCTACACCCCCTCCCCTGCCCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP6

The NM_007078.3(LDB3):​c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC​(p.Pro441_Ser448del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. S440S) has been classified as Likely benign.

Frequency

Genomes: 𝑓 0.000087 ( 0 hom., cov: 26)
Exomes 𝑓: 0.000093 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

LDB3
NM_007078.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3B:2

Conservation

PhyloP100: 2.40

Publications

0 publications found
Variant links:
Genes affected
LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
LDB3 Gene-Disease associations (from GenCC):
  • myofibrillar myopathy 4
    Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
  • familial isolated dilated cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • dilated cardiomyopathy
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • familial dilated cardiomyopathy
    Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
  • arrhythmogenic right ventricular cardiomyopathy
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_007078.3.
BP6
Variant 10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is Benign according to our data. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 45514.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LDB3NM_007078.3 linkc.1320_1343delCCCTGCCCCTGCCTACACCCCCTC p.Pro441_Ser448del disruptive_inframe_deletion Exon 10 of 14 ENST00000361373.9 NP_009009.1 O75112-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LDB3ENST00000361373.9 linkc.1320_1343delCCCTGCCCCTGCCTACACCCCCTC p.Pro441_Ser448del disruptive_inframe_deletion Exon 10 of 14 1 NM_007078.3 ENSP00000355296.3 O75112-1

Frequencies

GnomAD3 genomes
AF:
0.0000867
AC:
13
AN:
149868
Hom.:
0
Cov.:
26
show subpopulations
Gnomad AFR
AF:
0.000247
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.0000445
Gnomad OTH
AF:
0.00
GnomAD2 exomes
AF:
0.000114
AC:
28
AN:
244960
AF XY:
0.0000826
show subpopulations
Gnomad AFR exome
AF:
0.000189
Gnomad AMR exome
AF:
0.000379
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.0000549
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.0000551
Gnomad OTH exome
AF:
0.000332
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000932
AC:
136
AN:
1458552
Hom.:
0
AF XY:
0.0000923
AC XY:
67
AN XY:
725534
show subpopulations
African (AFR)
AF:
0.000989
AC:
33
AN:
33374
American (AMR)
AF:
0.000403
AC:
18
AN:
44644
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
26076
East Asian (EAS)
AF:
0.0000756
AC:
3
AN:
39680
South Asian (SAS)
AF:
0.0000814
AC:
7
AN:
86040
European-Finnish (FIN)
AF:
0.0000188
AC:
1
AN:
53148
Middle Eastern (MID)
AF:
0.00121
AC:
5
AN:
4132
European-Non Finnish (NFE)
AF:
0.0000468
AC:
52
AN:
1111282
Other (OTH)
AF:
0.000283
AC:
17
AN:
60176
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.412
Heterozygous variant carriers
0
6
13
19
26
32
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
4
8
12
16
20
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000867
AC:
13
AN:
149976
Hom.:
0
Cov.:
26
AF XY:
0.0000820
AC XY:
6
AN XY:
73172
show subpopulations
African (AFR)
AF:
0.000246
AC:
10
AN:
40662
American (AMR)
AF:
0.00
AC:
0
AN:
15042
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3432
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5062
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4626
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10466
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
294
European-Non Finnish (NFE)
AF:
0.0000445
AC:
3
AN:
67410
Other (OTH)
AF:
0.00
AC:
0
AN:
2078
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.437
Heterozygous variant carriers
0
1
2
3
4
5
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
Alfa
AF:
0.0000480
Hom.:
0

ClinVar

Significance: Conflicting classifications of pathogenicity
Submissions summary: Uncertain:3Benign:2
Revision: criteria provided, conflicting classifications
LINK: link

Submissions by phenotype

not provided Uncertain:1Benign:1
Jun 06, 2016
Stanford Center for Inherited Cardiovascular Disease, Stanford University
Significance:Uncertain significance
Review Status:no assertion criteria provided
Collection Method:provider interpretation

c.1320_1343del (p.Ala442_Pro449del) in LDB3 Given the lack of case data and location of the in-frame deletion in a region of repetitive sequence within the gene, we consider this variant to be of uncertain significance and we do not feel it is suitable for assessing risk in healthy relatives ("predictive genetic testing"). The variant has been seen in at least 1 unrelated case of DCM (not including this patient's family). We have seen the variant in a patient with DCM and a very likely pathogenic LMNA variant. Testing was done by Invitae. Pugh et al., 2014 reported the variant in an individual with DCM. The Invitae report notes, "This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residue(s) in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame...The functional effect of in-frame deletions in LDB3 is unknown." This variant is absent from ExAC, the Exome Aggregation Consortium dataset (http://exac.broadinstitute.org/), which currently includes variant calls on ~64,000 individuals of European, African, Latino and Asian descent (as of 6/6/2016). The mean coverage at that site in ExAC is 16x to ~20x. -

Apr 05, 2021
GeneDx
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

not specified Uncertain:1
Apr 11, 2012
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The 1320_1343del variant (LDB3) has not been reported in the literature nor prev iously identified by our laboratory. However, one individual with DCM was found to have a duplication of the same region. This variant causes an in-frame dele tion of 8 amino acids and is within a region of repeating sequence within the LD B3 gene. This may make this region prone to deletions and duplication, but it r emains unclear whether an increased or decreased number of repeats impacts the p rotein. In summary, additional information is needed to fully assess the clinic al significance of the 1320_1343del variant. -

Myofibrillar myopathy 4 Uncertain:1
Jan 11, 2025
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The LDB3 gene has multiple clinically relevant transcripts. This variant occurs in alternate transcript NM_007078.3, and corresponds to NM_001080116.1:c.*17041_*17064del in the primary transcript. This variant, c.1320_1343del, results in the deletion of 8 amino acid(s) of the LDB3 protein (p.Ala442_Pro449del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with dilated cardiomyopathy (PMID: 24503780, 27532257). ClinVar contains an entry for this variant (Variation ID: 45514). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Cardiovascular phenotype Benign:1
Mar 08, 2018
Ambry Genetics
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.4
Mutation Taster
=112/88
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134; API