chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C

Variant names:

• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C
• rs397517209
• NM_007078.3:c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP6

The NM_007078.3(LDB3):​c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC​(p.Pro441_Ser448del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. S440S) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000087 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000093 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: LDB3 NM_007078.3 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:2
• Conservation: PhyloP100: 2.40
• Publications: 0 publications found

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

LDB3 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD, AR Classification: STRONG, LIMITED Submitted by: ClinGen
• myofibrillar myopathy 4

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial dilated cardiomyopathy

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.
• BP6: Variant 10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is Benign according to our data. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 45514.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007078.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	NM_007078.3	MANE Select	c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC	p.Pro441_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	NP_009009.1	O75112-1
	LDB3	NM_001171610.2		c.1335_1358delCCCTGCCCCTGCCTACACCCCCTC	p.Pro446_Ser453del	disruptive_inframe_deletion	Exon 10 of 14	NP_001165081.1	O75112-7
	LDB3	NM_001368066.1		c.1179_1202delCCCTGCCCCTGCCTACACCCCCTC	p.Pro394_Ser401del	disruptive_inframe_deletion	Exon 11 of 15	NP_001354995.1	A0A8I5KV04

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	ENST00000361373.9	TSL:1 MANE Select	c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC	p.Pro441_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	ENSP00000355296.3	O75112-1
	LDB3	ENST00000945680.1		c.1524_1547delCCCTGCCCCTGCCTACACCCCCTC	p.Pro509_Ser516del	disruptive_inframe_deletion	Exon 10 of 14	ENSP00000615739.1
	LDB3	ENST00000871464.1		c.1461_1484delCCCTGCCCCTGCCTACACCCCCTC	p.Pro488_Ser495del	disruptive_inframe_deletion	Exon 11 of 15	ENSP00000541523.1

Frequencies

GnomAD3 genomes AF: 0.0000867 AC: 13 AN: 149868 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.000247

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000445

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000114 AC: 28 AN: 244960 AF XY: 0.0000826

Gnomad AFR exome AF: 0.000189

Gnomad AMR exome AF: 0.000379

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000549

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000551

Gnomad OTH exome AF: 0.000332

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000932 AC: 136 AN: 1458552 Hom.: 0 AF XY: 0.0000923 AC XY: 67 AN XY: 725534

African (AFR) AF: 0.000989 AC: 33 AN: 33374

American (AMR) AF: 0.000403 AC: 18 AN: 44644

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26076

East Asian (EAS) AF: 0.0000756 AC: 3 AN: 39680

South Asian (SAS) AF: 0.0000814 AC: 7 AN: 86040

European-Finnish (FIN) AF: 0.0000188 AC: 1 AN: 53148

Middle Eastern (MID) AF: 0.00121 AC: 5 AN: 4132

European-Non Finnish (NFE) AF: 0.0000468 AC: 52 AN: 1111282

Other (OTH) AF: 0.000283 AC: 17 AN: 60176

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000867 AC: 13 AN: 149976 Hom.: 0 Cov.: 26 AF XY: 0.0000820 AC XY: 6 AN XY: 73172

African (AFR) AF: 0.000246 AC: 10 AN: 40662

American (AMR) AF: 0.00 AC: 0 AN: 15042

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3432

East Asian (EAS) AF: 0.00 AC: 0 AN: 5062

South Asian (SAS) AF: 0.00 AC: 0 AN: 4626

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10466

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000445 AC: 3 AN: 67410

Other (OTH) AF: 0.00 AC: 0 AN: 2078

Alfa AF: 0.0000480 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	1	not provided (2)
-	-	1	Cardiovascular phenotype (1)
-	1	-	Myofibrillar myopathy 4 (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=112/88	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134;