NM_007078.3:c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC

Variant names:

• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C
• rs397517209
• NM_007078.3:c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM4 BP6

The NM_007078.3(LDB3):​c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC​(p.Pro441_Ser448del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000087 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000093 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: LDB3 NM_007078.3 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:2
• Conservation: PhyloP100: 2.40

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.
• BP6: Variant 10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is Benign according to our data. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 45514.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=2, Uncertain_significance=2}. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is described in Lovd as [Likely_benign]. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTG-C is described in Lovd as [Likely_benign].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LDB3	NM_007078.3	c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC	p.Pro441_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	ENST00000361373.9	NP_009009.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LDB3	ENST00000361373.9	c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC	p.Pro441_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	1	NM_007078.3	ENSP00000355296.3

Frequencies

GnomAD3 genomes AF: 0.00 AC: 13 AN: 149868 Hom.: 0 Cov.: 26 FAILED QC

Gnomad AFR AF: 0.000247

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000445

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000114 AC: 28 AN: 244960 Hom.: 0 AF XY: 0.0000826 AC XY: 11 AN XY: 133132

Gnomad AFR exome AF: 0.000189

Gnomad AMR exome AF: 0.000379

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000549

Gnomad SAS exome AF: 0.0000992

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000551

Gnomad OTH exome AF: 0.000332

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000932 AC: 136 AN: 1458552 Hom.: 0 AF XY: 0.0000923 AC XY: 67 AN XY: 725534

Gnomad4 AFR exome AF: 0.000989

Gnomad4 AMR exome AF: 0.000403

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000756

Gnomad4 SAS exome AF: 0.0000814

Gnomad4 FIN exome AF: 0.0000188

Gnomad4 NFE exome AF: 0.0000468

Gnomad4 OTH exome AF: 0.000283

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000867 AC: 13 AN: 149976 Hom.: 0 Cov.: 26 AF XY: 0.0000820 AC XY: 6 AN XY: 73172

Gnomad4 AFR AF: 0.000246

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000445

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000480 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:3 Benign:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:1

Jun 06, 2016

Stanford Center for Inherited Cardiovascular Disease, Stanford University

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: provider interpretation

c.1320_1343del (p.Ala442_Pro449del) in LDB3 Given the lack of case data and location of the in-frame deletion in a region of repetitive sequence within the gene, we consider this variant to be of uncertain significance and we do not feel it is suitable for assessing risk in healthy relatives ("predictive genetic testing"). The variant has been seen in at least 1 unrelated case of DCM (not including this patient's family). We have seen the variant in a patient with DCM and a very likely pathogenic LMNA variant. Testing was done by Invitae. Pugh et al., 2014 reported the variant in an individual with DCM. The Invitae report notes, "This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residue(s) in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame...The functional effect of in-frame deletions in LDB3 is unknown." This variant is absent from ExAC, the Exome Aggregation Consortium dataset (http://exac.broadinstitute.org/), which currently includes variant calls on ~64,000 individuals of European, African, Latino and Asian descent (as of 6/6/2016). The mean coverage at that site in ExAC is 16x to ~20x. -

Apr 05, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not specified Uncertain:1

Apr 11, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The 1320_1343del variant (LDB3) has not been reported in the literature nor prev iously identified by our laboratory. However, one individual with DCM was found to have a duplication of the same region. This variant causes an in-frame dele tion of 8 amino acids and is within a region of repeating sequence within the LD B3 gene. This may make this region prone to deletions and duplication, but it r emains unclear whether an increased or decreased number of repeats impacts the p rotein. In summary, additional information is needed to fully assess the clinic al significance of the 1320_1343del variant. -

Myofibrillar myopathy 4 Uncertain:1

Jan 11, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The LDB3 gene has multiple clinically relevant transcripts. This variant occurs in alternate transcript NM_007078.3, and corresponds to NM_001080116.1:c.*17041_*17064del in the primary transcript. This variant, c.1320_1343del, results in the deletion of 8 amino acid(s) of the LDB3 protein (p.Ala442_Pro449del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with dilated cardiomyopathy (PMID: 24503780, 27532257). ClinVar contains an entry for this variant (Variation ID: 45514). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Cardiovascular phenotype Benign:1

Mar 08, 2018

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134;