10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG

Variant names:

• chr10-86716424-T-TGCCTACACCCCCTCCCCTGCCCCT
• NM_007078.3:c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_007078.3(LDB3):​c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC​(p.Ser448_Pro449insProAlaProAlaTyrThrProSer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. S448S) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 0)
• Consequence: LDB3 NM_007078.3 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.985
• Publications: 0 publications found

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

LDB3 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD, AR Classification: STRONG, LIMITED Submitted by: ClinGen
• myofibrillar myopathy 4

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial dilated cardiomyopathy

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007078.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	NM_007078.3	MANE Select	c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser448_Pro449insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	NP_009009.1	O75112-1
	LDB3	NM_001171610.2		c.1335_1358dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser453_Pro454insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	NP_001165081.1	O75112-7
	LDB3	NM_001368066.1		c.1179_1202dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser401_Pro402insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 11 of 15	NP_001354995.1	A0A8I5KV04

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	ENST00000361373.9	TSL:1 MANE Select	c.1320_1343dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser448_Pro449insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	ENSP00000355296.3	O75112-1
	LDB3	ENST00000945680.1		c.1524_1547dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser516_Pro517insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 10 of 14	ENSP00000615739.1
	LDB3	ENST00000871464.1		c.1461_1484dupCCCTGCCCCTGCCTACACCCCCTC	p.Ser495_Pro496insProAlaProAlaTyrThrProSer	disruptive_inframe_insertion	Exon 11 of 15	ENSP00000541523.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.98

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr10-88476181;