11-47349867-AGGCGGCTTCAGGAGGCTGGC-A

Variant names:

• chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A
• rs397516058
• NM_000256.3:c.541_560delGCCAGCCTCCTGAAGCCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000256.3(MYBPC3):​c.541_560delGCCAGCCTCCTGAAGCCGCC​(p.Ala181CysfsTer53) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.99
• Publications: 3 publications found

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

MYBPC3 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• hypertrophic cardiomyopathy 4

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• left ventricular noncompaction 10

  Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• atrial fibrillation

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is Pathogenic according to our data. Variant chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 42770.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	NM_000256.3	MANE Select	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift	Exon 5 of 35	NP_000247.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	ENST00000545968.6	TSL:5 MANE Select	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift	Exon 5 of 35	ENSP00000442795.1
	MYBPC3	ENST00000399249.6	TSL:5	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift	Exon 5 of 34	ENSP00000382193.2
	MYBPC3	ENST00000544791.1	TSL:5	n.541_560delGCCAGCCTCCTGAAGCCGCC		non_coding_transcript_exon	Exon 5 of 27	ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypertrophic cardiomyopathy Pathogenic:1

Nov 30, 2010

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Ala181fs has not been reported in the literature. However, this variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 181 and leads to a premature stop codon 53 amino acids downst ream. This alteration is then predicted to lead to a truncated or absent protei n. Loss of function is an established mechanism of disease for the MYBPC3 gene, which makes it highly likely that the Ala181fs variant is pathogenic.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397516058; hg19: chr11-47371418;