rs397516058

Variant names:

• chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A
• rs397516058
• NM_000256.3:c.541_560delGCCAGCCTCCTGAAGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000256.3(MYBPC3):​c.541_560delGCCAGCCTCCTGAAGCCGCC​(p.Ala181CysfsTer53) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.99

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is Pathogenic according to our data. Variant chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 42770.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift_variant	Exon 5 of 35	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift_variant	Exon 5 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.541_560delGCCAGCCTCCTGAAGCCGCC	p.Ala181CysfsTer53	frameshift_variant	Exon 5 of 34	5		ENSP00000382193.2
MYBPC3	ENST00000544791.1	n.541_560delGCCAGCCTCCTGAAGCCGCC		non_coding_transcript_exon_variant	Exon 5 of 27	5		ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypertrophic cardiomyopathy Pathogenic:1

Nov 30, 2010

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Ala181fs has not been reported in the literature. However, this variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 181 and leads to a premature stop codon 53 amino acids downst ream. This alteration is then predicted to lead to a truncated or absent protei n. Loss of function is an established mechanism of disease for the MYBPC3 gene, which makes it highly likely that the Ala181fs variant is pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516058; hg19: chr11-47371418;