12-48904954-GGCCAAGGAGGAACACAACAGT-G

Variant names:

• chr12-48904954-GGCCAAGGAGGAACACAACAGT-G
• rs1187237772
• NM_033124.5:c.144_164delCAAGGAGGAACACAACAGTGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_033124.5(DRC2):​c.144_164delCAAGGAGGAACACAACAGTGC​(p.Lys49_Ala55del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A48A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DRC2 NM_033124.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.41
• Publications: 0 publications found

Genes affected

DRC2 (HGNC:29937): (coiled-coil domain containing 65) This gene encodes a sperm tail protein that is highly expressed in adult testis, spermatocytes and spermatids. The protein plays a critical role in the assembly of the nexin-dynein regulatory complex. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]

DRC2 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 27

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000272822 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_033124.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033124.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DRC2	NM_033124.5	MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	NP_149115.2
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_region	Exon 2 of 8	NP_001273886.1
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_acceptor splice_region 5_prime_UTR intron	Exon 2 of 8	NP_001273886.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CCDC65	ENST00000320516.5	TSL:1 MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	ENSP00000312706.4
	ENSG00000272822	ENST00000398092.4	TSL:3	c.385-1067_385-1047delACTGTTGTGTTCCTCCTTGGC		intron	N/A	ENSP00000438507.1
	CCDC65	ENST00000266984.9	TSL:5	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 9	ENSP00000266984.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia 27 Uncertain:1

Oct 18, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.144_164del, results in the deletion of 7 amino acids of the CCDC65 protein (p.Lys49_Ala55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with CCDC65-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=36/164	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1187237772; hg19: chr12-49298737;