chr12-48904954-GGCCAAGGAGGAACACAACAGT-G
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_033124.5(DRC2):c.144_164delCAAGGAGGAACACAACAGTGC(p.Lys49_Ala55del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A48A) has been classified as Likely benign.
Frequency
Consequence
NM_033124.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- primary ciliary dyskinesia 27Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
- primary ciliary dyskinesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| DRC2 | NM_033124.5 | c.144_164delCAAGGAGGAACACAACAGTGC | p.Lys49_Ala55del | disruptive_inframe_deletion | Exon 2 of 8 | ENST00000320516.5 | NP_149115.2 | |
| DRC2 | NM_001286957.2 | c.-279-7_-266delCAAGGAGGAACACAACAGTGC | splice_region_variant | Exon 2 of 8 | NP_001273886.1 | |||
| DRC2 | NM_001286957.2 | c.-279-7_-266delCAAGGAGGAACACAACAGTGC | splice_acceptor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 2 of 8 | NP_001273886.1 | |||
| DRC2 | NM_001286957.2 | c.-279-7_-266delCAAGGAGGAACACAACAGTGC | non_coding_transcript_variant | NP_001273886.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CCDC65 | ENST00000320516.5 | c.144_164delCAAGGAGGAACACAACAGTGC | p.Lys49_Ala55del | disruptive_inframe_deletion | Exon 2 of 8 | 1 | NM_033124.5 | ENSP00000312706.4 | ||
| ENSG00000272822 | ENST00000398092.4 | c.385-1067_385-1047delACTGTTGTGTTCCTCCTTGGC | intron_variant | Intron 4 of 4 | 3 | ENSP00000438507.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Primary ciliary dyskinesia 27 Uncertain:1
This variant, c.144_164del, results in the deletion of 7 amino acids of the CCDC65 protein (p.Lys49_Ala55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with CCDC65-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at