NM_033124.5:c.144_164delCAAGGAGGAACACAACAGTGC

Variant names:

• chr12-48904954-GGCCAAGGAGGAACACAACAGT-G
• rs1187237772
• NM_033124.5:c.144_164delCAAGGAGGAACACAACAGTGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_033124.5(DRC2):​c.144_164delCAAGGAGGAACACAACAGTGC​(p.Lys49_Ala55del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A48A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DRC2 NM_033124.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.41
• Publications: 0 publications found

Genes affected

DRC2 (HGNC:29937): (coiled-coil domain containing 65) This gene encodes a sperm tail protein that is highly expressed in adult testis, spermatocytes and spermatids. The protein plays a critical role in the assembly of the nexin-dynein regulatory complex. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]

DRC2 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 27

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000272822 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_033124.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033124.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DRC2	NM_033124.5	MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	NP_149115.2	Q8IXS2-1
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_region	Exon 2 of 8	NP_001273886.1	B4DXQ7
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_acceptor splice_region 5_prime_UTR intron	Exon 2 of 8	NP_001273886.1	B4DXQ7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CCDC65	ENST00000320516.5	TSL:1 MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	ENSP00000312706.4	Q8IXS2-1
	ENSG00000272822	ENST00000398092.4	TSL:3	c.385-1067_385-1047delACTGTTGTGTTCCTCCTTGGC		intron	N/A	ENSP00000438507.1	F5H423
	CCDC65	ENST00000266984.9	TSL:5	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 9	ENSP00000266984.5	Q8IXS2-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Primary ciliary dyskinesia 27 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=36/164	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1187237772; hg19: chr12-49298737;