rs1187237772

Variant names:

• chr12-48904954-GGCCAAGGAGGAACACAACAGT-G
• rs1187237772
• NM_033124.5:c.144_164delCAAGGAGGAACACAACAGTGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_001286957.2(DRC2):​c.-279-7_-266delCAAGGAGGAACACAACAGTGC variant causes a splice acceptor, splice region, 5 prime UTR, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: DRC2 NM_001286957.2 splice_acceptor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.41
• Publications: 0 publications found

Genes affected

DRC2 (HGNC:29937): (coiled-coil domain containing 65) This gene encodes a sperm tail protein that is highly expressed in adult testis, spermatocytes and spermatids. The protein plays a critical role in the assembly of the nexin-dynein regulatory complex. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]

DRC2 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 27

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000272822 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.14619882 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of -18, new splice context is: atatttattccttcacacAGgac. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001286957.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DRC2	NM_033124.5	MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	NP_149115.2	Q8IXS2-1
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_region	Exon 2 of 8	NP_001273886.1	B4DXQ7
	DRC2	NM_001286957.2		c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_acceptor splice_region 5_prime_UTR intron	Exon 2 of 8	NP_001273886.1	B4DXQ7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CCDC65	ENST00000320516.5	TSL:1 MANE Select	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	ENSP00000312706.4	Q8IXS2-1
	ENSG00000272822	ENST00000398092.4	TSL:3	c.385-1067_385-1047delACTGTTGTGTTCCTCCTTGGC		intron	N/A	ENSP00000438507.1	F5H423
	CCDC65	ENST00000266984.9	TSL:5	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 9	ENSP00000266984.5	Q8IXS2-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Primary ciliary dyskinesia 27 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=36/164	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1187237772; hg19: chr12-49298737;