rs1187237772

Variant names:

• chr12-48904954-GGCCAAGGAGGAACACAACAGT-G
• rs1187237772
• NM_033124.5:c.144_164delCAAGGAGGAACACAACAGTGC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_001286957.2(CCDC65):​c.-279-7_-266delCAAGGAGGAACACAACAGTGC variant causes a splice acceptor, splice region, 5 prime UTR, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CCDC65 NM_001286957.2 splice_acceptor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.41

Genes affected

CCDC65 (HGNC:29937): (coiled-coil domain containing 65) This gene encodes a sperm tail protein that is highly expressed in adult testis, spermatocytes and spermatids. The protein plays a critical role in the assembly of the nexin-dynein regulatory complex. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]

ENSG00000272822 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.14619882 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.5, offset of -18, new splice context is: atatttattccttcacacAGgac. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CCDC65	NM_033124.5	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	ENST00000320516.5	NP_149115.2
CCDC65	NM_001286957.2	c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_region_variant	Exon 2 of 8		NP_001273886.1
CCDC65	NM_001286957.2	c.-279-7_-266delCAAGGAGGAACACAACAGTGC		splice_acceptor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 2 of 8		NP_001273886.1
CCDC65	NM_001286957.2	c.-279-7_-266delCAAGGAGGAACACAACAGTGC		non_coding_transcript_variant			NP_001273886.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CCDC65	ENST00000320516.5	c.144_164delCAAGGAGGAACACAACAGTGC	p.Lys49_Ala55del	disruptive_inframe_deletion	Exon 2 of 8	1	NM_033124.5	ENSP00000312706.4
ENSG00000272822	ENST00000398092.4	c.385-1067_385-1047delACTGTTGTGTTCCTCCTTGGC		intron_variant	Intron 4 of 4	3		ENSP00000438507.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia 27 Uncertain:1

Oct 18, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.144_164del, results in the deletion of 7 amino acids of the CCDC65 protein (p.Lys49_Ala55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with CCDC65-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1187237772; hg19: chr12-49298737;