12-6841559-CTCCCCTGATGTCTGCTTTCCCTGCAGGA-C

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The NM_002075.4(GNB3):​c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT​(p.Asp20_Ala21del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

GNB3
NM_002075.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.95
Variant links:
Genes affected
GNB3 (HGNC:4400): (G protein subunit beta 3) Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.038123168 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4.9, offset of 9, new splice context is: tgctgacgttactctggcAGagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
GNB3NM_002075.4 linkc.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT p.Asp20_Ala21del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 3 of 10 ENST00000229264.8 NP_002066.1 P16520-1F1T0G5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
GNB3ENST00000229264.8 linkc.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT p.Asp20_Ala21del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 3 of 10 5 NM_002075.4 ENSP00000229264.3 P16520-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Sep 07, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 1022034). This variant has not been reported in the literature in individuals affected with GNB3-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 3 (c.58-25_60del) of the GNB3 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in GNB3 cause disease. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1943574339; hg19: chr12-6950723; API