chr12-6841559-CTCCCCTGATGTCTGCTTTCCCTGCAGGA-C
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2
The NM_002075.4(GNB3):c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT(p.Asp20_Ala21del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_002075.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
GNB3 | ENST00000229264.8 | c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT | p.Asp20_Ala21del | splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | Exon 3 of 10 | 5 | NM_002075.4 | ENSP00000229264.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 1022034). This variant has not been reported in the literature in individuals affected with GNB3-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 3 (c.58-25_60del) of the GNB3 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in GNB3 cause disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at