NM_002075.4:c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate
The NM_002075.4(GNB3):c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT(p.Asp20_Ala21del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_002075.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- congenital stationary night blindnessInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- congenital stationary night blindness 1HInheritance: AR, Unknown Classification: LIMITED Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002075.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GNB3 | MANE Select | c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT | p.Asp20_Ala21del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 3 of 10 | NP_002066.1 | P16520-1 | ||
| GNB3 | c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT | p.Asp20_Ala21del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 3 of 10 | NP_001284500.1 | E9PCP0 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GNB3 | TSL:5 MANE Select | c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT | p.Asp20_Ala21del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 3 of 10 | ENSP00000229264.3 | P16520-1 | ||
| GNB3 | TSL:1 | c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT | p.Asp20_Ala21del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 3 of 10 | ENSP00000414734.2 | E9PCP0 | ||
| GNB3 | TSL:1 | n.521_548delCCCCTGATGTCTGCTTTCCCTGCAGGAT | non_coding_transcript_exon | Exon 1 of 2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at