rs1943574339

Variant names:

• chr12-6841559-CTCCCCTGATGTCTGCTTTCCCTGCAGGA-C
• rs1943574339
• NM_002075.4:c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_002075.4(GNB3):​c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT​(p.Asp20_Ala21del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: GNB3 NM_002075.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.95
• Publications: 0 publications found

Genes affected

GNB3 (HGNC:4400): (G protein subunit beta 3) Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]

GNB3 Gene-Disease associations (from GenCC):

• congenital stationary night blindness

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• congenital stationary night blindness 1H

  Inheritance: AR, Unknown Classification: LIMITED Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.038123168 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4.9, offset of 9, new splice context is: tgctgacgttactctggcAGagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002075.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNB3	NM_002075.4	MANE Select	c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT	p.Asp20_Ala21del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 10	NP_002066.1	P16520-1
	GNB3	NM_001297571.2		c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT	p.Asp20_Ala21del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 10	NP_001284500.1	E9PCP0

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNB3	ENST00000229264.8	TSL:5 MANE Select	c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT	p.Asp20_Ala21del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 10	ENSP00000229264.3	P16520-1
	GNB3	ENST00000435982.6	TSL:1	c.58-25_60delCCCCTGATGTCTGCTTTCCCTGCAGGAT	p.Asp20_Ala21del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 10	ENSP00000414734.2	E9PCP0
	GNB3	ENST00000542868.1	TSL:1	n.521_548delCCCCTGATGTCTGCTTTCCCTGCAGGAT		non_coding_transcript_exon	Exon 1 of 2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1943574339; hg19: chr12-6950723;