13-48303689-AGCCTCGCGGACGTGACGCCGCGG-A

Variant names:

• chr13-48303689-AGCCTCGCGGACGTGACGCCGCGG-A
• rs36230211
• ENST00000433480.4:n.12_34delCCGCGGCGTCACGTCCGCGAGGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6

The ENST00000433480.4(RB1-DT):​n.12_34delCCGCGGCGTCACGTCCGCGAGGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000109 in 624,244 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00011 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00011 (0 hom.)
• Consequence: RB1-DT ENST00000433480.4 non_coding_transcript_exon
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:1
• Conservation: PhyloP100: 2.72
• Publications: 2 publications found

Genes affected

RB1-DT (HGNC:42778): (RB1 divergent transcript)

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1 Gene-Disease associations (from GenCC):

• hereditary retinoblastoma

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• retinoblastoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• melanoma

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP6: Variant 13-48303689-AGCCTCGCGGACGTGACGCCGCGG-A is Benign according to our data. Variant chr13-48303689-AGCCTCGCGGACGTGACGCCGCGG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 2443575.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000433480.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1-DT	NR_046414.2		n.-10_13delCCGCGGCGTCACGTCCGCGAGGC		non_coding_transcript_exon	Exon 1 of 3
	RB1	NM_000321.3	MANE Select	c.-223_-201delGCCTCGCGGACGTGACGCCGCGG		upstream_gene	N/A	NP_000312.2	P06400
	RB1	NM_001407165.1		c.-223_-201delGCCTCGCGGACGTGACGCCGCGG		upstream_gene	N/A	NP_001394094.1	A0A3B3IS71

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1-DT	ENST00000433480.4	TSL:1	n.12_34delCCGCGGCGTCACGTCCGCGAGGC		non_coding_transcript_exon	Exon 1 of 3
	RB1-DT	ENST00000436963.3	TSL:3	n.9_31delCCGCGGCGTCACGTCCGCGAGGC		non_coding_transcript_exon	Exon 1 of 3
	RB1-DT	ENST00000700890.2		n.12_34delCCGCGGCGTCACGTCCGCGAGGC		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes AF: 0.000105 AC: 16 AN: 152062 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000262

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000177

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000110 AC: 52 AN: 472064 Hom.: 0 AF XY: 0.0000856 AC XY: 21 AN XY: 245200

African (AFR) AF: 0.00 AC: 0 AN: 9288

American (AMR) AF: 0.00 AC: 0 AN: 9716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 12298

East Asian (EAS) AF: 0.00 AC: 0 AN: 23612

South Asian (SAS) AF: 0.00 AC: 0 AN: 41214

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27502

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1944

European-Non Finnish (NFE) AF: 0.000156 AC: 50 AN: 320896

Other (OTH) AF: 0.0000781 AC: 2 AN: 25594

GnomAD4 genome AF: 0.000105 AC: 16 AN: 152180 Hom.: 0 Cov.: 32 AF XY: 0.000108 AC XY: 8 AN XY: 74404

African (AFR) AF: 0.00 AC: 0 AN: 41508

American (AMR) AF: 0.000261 AC: 4 AN: 15308

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5166

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000177 AC: 12 AN: 67978

Other (OTH) AF: 0.00 AC: 0 AN: 2114

Alfa AF: 0.000142 Hom.: 0

Bravo AF: 0.000106

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	-	1	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)
-	1	-	RB1-related disorder (1)
-	1	-	Retinoblastoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs36230211; hg19: chr13-48877825;