rs36230211
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6
The ENST00000433480.4(RB1-DT):n.12_34delCCGCGGCGTCACGTCCGCGAGGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000109 in 624,244 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
ENST00000433480.4 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- hereditary retinoblastomaInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Ambry Genetics
- retinoblastomaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- melanomaInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RB1 | NM_000321.3 | c.-223_-201delGCCTCGCGGACGTGACGCCGCGG | upstream_gene_variant | ENST00000267163.6 | NP_000312.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000105 AC: 16AN: 152062Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.000110 AC: 52AN: 472064Hom.: 0 AF XY: 0.0000856 AC XY: 21AN XY: 245200 show subpopulations
GnomAD4 genome AF: 0.000105 AC: 16AN: 152180Hom.: 0 Cov.: 32 AF XY: 0.000108 AC XY: 8AN XY: 74404 show subpopulations
ClinVar
Submissions by phenotype
Retinoblastoma Uncertain:1
This variant occurs in a non-coding region of the RB1 gene. It does not change the encoded amino acid sequence of the RB1 protein. This variant is present in population databases (rs36230211, gnomAD 0.02%). This variant has not been reported in the literature in individuals affected with RB1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
Has not been previously published as pathogenic or benign to our knowledge; Located in a regulatory region; in the absence of functional studies, the actual effect of this sequence change is unknown -
RB1-related disorder Uncertain:1
The RB1 c.-221_-199del23 variant is located in the 5' untranslated region. To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.019% of alleles in individuals of European (Non-Finnish) descent in gnomAD (http://gnomad.broadinstitute.org/variant/13-48877825-AGCCTCGCGGACGTGACGCCGCGG-A). Of note, variants within the RB1 promoter region have been reported in individuals with retinooblastoma (e.g. Ottaviani et al. 2013. PubMed ID: 23301675; Taylor et al. 2007. PubMed ID: 17096365). At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Hereditary cancer-predisposing syndrome Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at