13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000321.3(RB1):​c.54_76dupGGAACCCCCGGCACCGCCGCCGC​(p.Pro26fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

RB1
NM_000321.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 2.04
Variant links:
Genes affected
RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 216 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is Pathogenic according to our data. Variant chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 428668.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
RB1NM_000321.3 linkuse as main transcriptc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26fs frameshift_variant 1/27 ENST00000267163.6 NP_000312.2 P06400A0A024RDV3
RB1NM_001407165.1 linkuse as main transcriptc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26fs frameshift_variant 1/27 NP_001394094.1
RB1NM_001407166.1 linkuse as main transcriptc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26fs frameshift_variant 1/17 NP_001394095.1
RB1NM_001407167.1 linkuse as main transcriptc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26fs frameshift_variant 1/3 NP_001394096.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
RB1ENST00000267163.6 linkuse as main transcriptc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26fs frameshift_variant 1/271 NM_000321.3 ENSP00000267163.4 P06400

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Retinoblastoma Pathogenic:2
Likely pathogenic, criteria provided, single submitterclinical testingBaylor GeneticsMar 22, 2023- -
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJan 18, 2023For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 428668). This premature translational stop signal has been observed in individual(s) with RB1-related conditions (PMID: 21520333). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro26Argfs*47) in the RB1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). -
Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsOct 02, 2012This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555279210; hg19: chr13-48878093; API