13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000321.3(RB1):​c.54_76dupGGAACCCCCGGCACCGCCGCCGC​(p.Pro26ArgfsTer47) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P26P) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

RB1
NM_000321.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 2.04

Publications

0 publications found
Variant links:
Genes affected
RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
RB1-DT (HGNC:42778): (RB1 divergent transcript)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 649 pathogenic variants in the truncated region.
PP5
Variant 13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is Pathogenic according to our data. Variant chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 428668.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RB1NM_000321.3 linkc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26ArgfsTer47 frameshift_variant Exon 1 of 27 ENST00000267163.6 NP_000312.2
RB1NM_001407165.1 linkc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26ArgfsTer47 frameshift_variant Exon 1 of 27 NP_001394094.1
RB1NM_001407166.1 linkc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26ArgfsTer47 frameshift_variant Exon 1 of 17 NP_001394095.1
RB1NM_001407167.1 linkc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26ArgfsTer47 frameshift_variant Exon 1 of 3 NP_001394096.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RB1ENST00000267163.6 linkc.54_76dupGGAACCCCCGGCACCGCCGCCGC p.Pro26ArgfsTer47 frameshift_variant Exon 1 of 27 1 NM_000321.3 ENSP00000267163.4

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Retinoblastoma Pathogenic:2
Dec 06, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Pro26Argfs*47) in the RB1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with RB1-related conditions (PMID: 21520333). ClinVar contains an entry for this variant (Variation ID: 428668). For these reasons, this variant has been classified as Pathogenic. -

Mar 22, 2023
Baylor Genetics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1
Oct 02, 2012
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.0
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555279210; hg19: chr13-48878093; API