13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC

Position:

• chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000321.3(RB1):​c.54_76dupGGAACCCCCGGCACCGCCGCCGC​(p.Pro26fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 2.04

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 216 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is Pathogenic according to our data. Variant chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 428668.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RB1	NM_000321.3	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26fs	frameshift_variant	1/27	ENST00000267163.6	NP_000312.2
RB1	NM_001407165.1	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26fs	frameshift_variant	1/27		NP_001394094.1
RB1	NM_001407166.1	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26fs	frameshift_variant	1/17		NP_001394095.1
RB1	NM_001407167.1	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26fs	frameshift_variant	1/3		NP_001394096.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RB1	ENST00000267163.6	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26fs	frameshift_variant	1/27	1	NM_000321.3	ENSP00000267163.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Retinoblastoma Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Baylor Genetics	Mar 22, 2023	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 18, 2023	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 428668). This premature translational stop signal has been observed in individual(s) with RB1-related conditions (PMID: 21520333). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro26Argfs*47) in the RB1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Oct 02, 2012

This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555279210; hg19: chr13-48878093;