rs1555279210

Variant names:

• chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC
• rs1555279210
• NM_000321.3:c.54_76dupGGAACCCCCGGCACCGCCGCCGC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000321.3(RB1):​c.54_76dupGGAACCCCCGGCACCGCCGCCGC​(p.Pro26ArgfsTer47) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P26P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 2.04
• Publications: 0 publications found

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1-DT (HGNC:42778): (RB1 divergent transcript)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 649 pathogenic variants in the truncated region.
• PP5: Variant 13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is Pathogenic according to our data. Variant chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 428668.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000321.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	NM_000321.3	MANE Select	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26ArgfsTer47	frameshift	Exon 1 of 27	NP_000312.2	P06400
	RB1	NM_001407165.1		c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26ArgfsTer47	frameshift	Exon 1 of 27	NP_001394094.1	A0A3B3IS71
	RB1	NM_001407166.1		c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26ArgfsTer47	frameshift	Exon 1 of 17	NP_001394095.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	ENST00000267163.6	TSL:1 MANE Select	c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26ArgfsTer47	frameshift	Exon 1 of 27	ENSP00000267163.4	P06400
	RB1	ENST00000467505.6	TSL:1	n.54_76dupGGAACCCCCGGCACCGCCGCCGC		non_coding_transcript_exon	Exon 1 of 22	ENSP00000434702.1	Q92728
	RB1	ENST00000924352.1		c.54_76dupGGAACCCCCGGCACCGCCGCCGC	p.Pro26ArgfsTer47	frameshift	Exon 1 of 28	ENSP00000594411.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Retinoblastoma (2)
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555279210; hg19: chr13-48878093;