chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000321.3(RB1):c.54_76dupGGAACCCCCGGCACCGCCGCCGC(p.Pro26fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Genomes: not found (cov: 32)
Consequence
RB1
NM_000321.3 frameshift
NM_000321.3 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.04
Genes affected
RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 216 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is Pathogenic according to our data. Variant chr13-48303957-T-TGCCGCCGCGGAACCCCCGGCACC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 428668.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RB1 | NM_000321.3 | c.54_76dupGGAACCCCCGGCACCGCCGCCGC | p.Pro26fs | frameshift_variant | 1/27 | ENST00000267163.6 | NP_000312.2 | |
RB1 | NM_001407165.1 | c.54_76dupGGAACCCCCGGCACCGCCGCCGC | p.Pro26fs | frameshift_variant | 1/27 | NP_001394094.1 | ||
RB1 | NM_001407166.1 | c.54_76dupGGAACCCCCGGCACCGCCGCCGC | p.Pro26fs | frameshift_variant | 1/17 | NP_001394095.1 | ||
RB1 | NM_001407167.1 | c.54_76dupGGAACCCCCGGCACCGCCGCCGC | p.Pro26fs | frameshift_variant | 1/3 | NP_001394096.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RB1 | ENST00000267163.6 | c.54_76dupGGAACCCCCGGCACCGCCGCCGC | p.Pro26fs | frameshift_variant | 1/27 | 1 | NM_000321.3 | ENSP00000267163.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 31
GnomAD4 exome
Cov.:
31
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Retinoblastoma Pathogenic:2
Likely pathogenic, criteria provided, single submitter | clinical testing | Baylor Genetics | Mar 22, 2023 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 18, 2023 | For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 428668). This premature translational stop signal has been observed in individual(s) with RB1-related conditions (PMID: 21520333). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro26Argfs*47) in the RB1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). - |
Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Oct 02, 2012 | This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at