15-48411220-CGATCAAGTATCTGTTGTGATTCGT-TC
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_ModeratePM2PP2
The NM_000138.5(FBN1):c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA(p.Thr2788fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 33)
Consequence
FBN1
NM_000138.5 frameshift, missense
NM_000138.5 frameshift, missense
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.30
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 5 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0295 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP2
Missense variant in gene, where missense usually causes diseases (based on misZ statistic), FBN1. . Gene score misZ 5.0644 (greater than the threshold 3.09). Trascript score misZ 8.1787 (greater than threshold 3.09). GenCC has associacion of gene with MASS syndrome, Weill-Marchesani syndrome, geleophysic dysplasia, Shprintzen-Goldberg syndrome, Acromicric dysplasia, familial thoracic aortic aneurysm and aortic dissection, progeroid and marfanoid aspect-lipodystrophy syndrome, ectopia lentis 1, isolated, autosomal dominant, Marfan syndrome, Weill-Marchesani syndrome 2, dominant, isolated ectopia lentis, neonatal Marfan syndrome, stiff skin syndrome.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
FBN1 | NM_000138.5 | c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA | p.Thr2788fs | frameshift_variant, missense_variant | 66/66 | ENST00000316623.10 | NP_000129.3 | |
FBN1 | NM_001406716.1 | c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA | p.Thr2788fs | frameshift_variant, missense_variant | 65/65 | NP_001393645.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
FBN1 | ENST00000316623.10 | c.8362_8386delACGAATCACAACAGATACTTGATCGinsGA | p.Thr2788fs | frameshift_variant, missense_variant | 66/66 | 1 | NM_000138.5 | ENSP00000325527.5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not specified Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine | Sep 26, 2011 | The Thr2788fs variant has not been reported in the literature nor identified by our laboratory. This variant is predicted to cause a frameshift which alters th e protein's amino acid sequence beginning at codon 2788 and resulting in a prema ture stop codon five amino acids downstream. This alteration is predicted to re sult in a protein truncated by approximately 79 amino acids (less than 3% of the total length of the FBN1 protein) since the premature stop codon is likely not sensitive to nonsense-mediated decay because it occurs in the terminal most exon . It is possible that this variant may impact essential amino acids in this dow nstream part of the protein. However, the true impact of this variant on the pro tein and its function remains unclear. In the absence of additional information , such as control data, functional analyses, or segregation studies, the clinica l significance of this variant cannot be determined at this time. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at