19-38502733-GCGGGGCAGGCTTCAGGGTGGGGCAGGGGCA-AGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000540.3(RYR1):​c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 17)

Consequence

RYR1
NM_000540.3 splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.30

Publications

0 publications found
Variant links:
Genes affected
RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
RYR1 Gene-Disease associations (from GenCC):
  • malignant hyperthermia, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
  • congenital multicore myopathy with external ophthalmoplegia
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
  • RYR1-related myopathy
    Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
  • central core myopathy
    Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • King-Denborough syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • malignant hyperthermia of anesthesia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • autosomal recessive centronuclear myopathy
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • benign Samaritan congenital myopathy
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • congenital myopathy with myasthenic-like onset
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • lethal multiple pterygium syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RYR1NM_000540.3 linkc.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC splice_region_variant, intron_variant Intron 48 of 105 ENST00000359596.8 NP_000531.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RYR1ENST00000359596.8 linkc.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC splice_region_variant, intron_variant Intron 48 of 105 5 NM_000540.3 ENSP00000352608.2

Frequencies

GnomAD3 genomes
Cov.:
17
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
17

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

RYR1-related disorder Uncertain:1
Jul 13, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change falls in intron 48 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein, but it affects a nucleotide within the consensus splice site of the intron. This variant is present in population databases (rs768070268, ExAC 0.001335%). This variant has not been reported in the literature in individuals with RYR1-related disease. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant is not likely to affect RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555784450; hg19: chr19-38993373; API