rs1555784450
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000540.3(RYR1):c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene RYR1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000540.3 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia
- RYR1-related myopathyInheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | MANE Select | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region intron | N/A | NP_000531.2 | P21817-1 | |||
| RYR1 | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region intron | N/A | NP_001036188.1 | P21817-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | TSL:5 MANE Select | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region intron | N/A | ENSP00000352608.2 | P21817-1 | |||
| RYR1 | TSL:1 | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region intron | N/A | ENSP00000347667.3 | P21817-2 | |||
| RYR1 | TSL:1 | n.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region intron | N/A | ENSP00000470927.2 | M0R014 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.