rs1555784450

Positions:

• chr19-38502732-AGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCA-AAGC

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_000540.3(RYR1):​c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 17)
• Consequence: RYR1 NM_000540.3 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.30

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RYR1	NM_000540.3	c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC		splice_region_variant, intron_variant		ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC		splice_region_variant, intron_variant		5	NM_000540.3	ENSP00000352608.2
RYR1	ENST00000355481.8	c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC		splice_region_variant, intron_variant		1		ENSP00000347667.3
RYR1	ENST00000594335.5	n.1286+6_1286+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC		splice_region_variant, intron_variant		1		ENSP00000470927.2
RYR1	ENST00000599547.6	n.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC		splice_region_variant, intron_variant		2		ENSP00000471601.2

Frequencies

GnomAD3 genomes Cov.: 17

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 17

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

RYR1-related disorder Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 13, 2021

This variant is present in population databases (rs768070268, ExAC 0.001335%). This sequence change falls in intron 48 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein, but it affects a nucleotide within the consensus splice site of the intron. This variant has not been reported in the literature in individuals with RYR1-related disease. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant is not likely to affect RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555784450; hg19: chr19-38993373;