19-38565561-CGAGGGCGCTGGAGACGCCGCG-C
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_000540.3(RYR1):c.13244_13264delCCGCGGAGGGCGCTGGAGACG(p.Ala4415_Asp4421del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000114 in 1,483,462 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_000540.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000145 AC: 22AN: 151962Hom.: 0 Cov.: 31
GnomAD3 exomes AF: 0.000152 AC: 13AN: 85708Hom.: 0 AF XY: 0.000144 AC XY: 7AN XY: 48658
GnomAD4 exome AF: 0.000110 AC: 147AN: 1331394Hom.: 0 AF XY: 0.000116 AC XY: 76AN XY: 656366
GnomAD4 genome AF: 0.000145 AC: 22AN: 152068Hom.: 0 Cov.: 31 AF XY: 0.000175 AC XY: 13AN XY: 74328
ClinVar
Submissions by phenotype
not provided Uncertain:3
- -
- -
In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -
RYR1-related disorder Uncertain:2
This variant, c.13244_13264del, results in the deletion of 7 amino acid(s) of the RYR1 protein (p.Ala4415_Asp4421del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs763413580, gnomAD 0.07%). This variant has been observed in individual(s) with clinical features of autosomal recessive RYR1-related conditions (PMID: 26994242; internal data). ClinVar contains an entry for this variant (Variation ID: 478181). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
The RYR1 c.13244_13264del21 variant is predicted to result in an in-frame deletion (p.Ala4415_Asp4421del). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.087% of alleles in individuals of East Asian descent in gnomAD (http://gnomad.broadinstitute.org/variant/19-39056201-CGAGGGCGCTGGAGACGCCGCG-C). At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
not specified Uncertain:1
Variant summary: RYR1 c.13244_13264del21 (p.Ala4415_Asp4421del) results in an in-frame deletion that is predicted to remove 7 amino acids from the encoded protein. The variant allele was found at a frequency of 0.00015 in 85708 control chromosomes, predominantly at a frequency of 0.00072 within the East Asian subpopulation in the gnomAD database. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.13244_13264del21 has been reported in the literature in at-least one individual affected with exertional heat stroke, without strong evidence for causality (example, Roux-Buisson_2016). These report(s) do not provide unequivocal conclusions about association of the variant with Malignant Hyperthermia Susceptibility. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance. -
Congenital multicore myopathy with external ophthalmoplegia Benign:1
The homozygous variant was found in patients diagnosed with another variant in a different gene, with no symptoms related to the gene containing the homozygous variant. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at