rs763413580

Variant names:

• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-C
• rs763413580
• NM_000540.3:c.13244_13264delCCGCGGAGGGCGCTGGAGACG

Your query was ambiguous. Multiple possible variants found:

• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-C
• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-CGAGGGCGCTGGAGACGCCGCGGAGGGCGCTGGAGACGCCGCG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_000540.3(RYR1):​c.13244_13264delCCGCGGAGGGCGCTGGAGACG​(p.Ala4415_Asp4421del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000114 in 1,483,462 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00014 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00011 (0 hom.)
• Consequence: RYR1 NM_000540.3 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:6 B:1
• Conservation: PhyloP100: 4.53

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RYR1	NM_000540.3	c.13244_13264delCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421del	disruptive_inframe_deletion	Exon 91 of 106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.13244_13264delCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421del	disruptive_inframe_deletion	Exon 91 of 106	5	NM_000540.3	ENSP00000352608.2

Frequencies

GnomAD3 genomes AF: 0.000145 AC: 22 AN: 151962 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00116

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000473

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000736

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000152 AC: 13 AN: 85708 Hom.: 0 AF XY: 0.000144 AC XY: 7 AN XY: 48658

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000562

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000720

Gnomad SAS exome AF: 0.000345

Gnomad FIN exome AF: 0.000405

Gnomad NFE exome AF: 0.0000320

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000110 AC: 147 AN: 1331394 Hom.: 0 AF XY: 0.000116 AC XY: 76 AN XY: 656366

Gnomad4 AFR exome AF: 0.000111

Gnomad4 AMR exome AF: 0.000136

Gnomad4 ASJ exome AF: 0.0000427

Gnomad4 EAS exome AF: 0.000877

Gnomad4 SAS exome AF: 0.000190

Gnomad4 FIN exome AF: 0.000908

Gnomad4 NFE exome AF: 0.0000483

Gnomad4 OTH exome AF: 0.000325

GnomAD4 genome AF: 0.000145 AC: 22 AN: 152068 Hom.: 0 Cov.: 31 AF XY: 0.000175 AC XY: 13 AN XY: 74328

Gnomad4 AFR AF: 0.000120

Gnomad4 AMR AF: 0.0000654

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00117

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000473

Gnomad4 NFE AF: 0.0000736

Gnomad4 OTH AF: 0.00

Bravo AF: 0.000144

Asia WGS AF: 0.00290 AC: 10 AN: 3466

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:6 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:3

Jan 10, 2025

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -

Jan 26, 2023

Revvity Omics, Revvity

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jun 25, 2020

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

RYR1-related disorder Uncertain:2

Feb 27, 2023

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The RYR1 c.13244_13264del21 variant is predicted to result in an in-frame deletion (p.Ala4415_Asp4421del). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.087% of alleles in individuals of East Asian descent in gnomAD (http://gnomad.broadinstitute.org/variant/19-39056201-CGAGGGCGCTGGAGACGCCGCG-C). At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Dec 14, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.13244_13264del, results in the deletion of 7 amino acid(s) of the RYR1 protein (p.Ala4415_Asp4421del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs763413580, gnomAD 0.07%). This variant has been observed in individual(s) with clinical features of autosomal recessive RYR1-related conditions (PMID: 26994242; internal data). ClinVar contains an entry for this variant (Variation ID: 478181). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Uncertain:1

Sep 13, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: RYR1 c.13244_13264del21 (p.Ala4415_Asp4421del) results in an in-frame deletion that is predicted to remove 7 amino acids from the encoded protein. The variant allele was found at a frequency of 0.00015 in 85708 control chromosomes, predominantly at a frequency of 0.00072 within the East Asian subpopulation in the gnomAD database. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.13244_13264del21 has been reported in the literature in at-least one individual affected with exertional heat stroke, without strong evidence for causality (example, Roux-Buisson_2016). These report(s) do not provide unequivocal conclusions about association of the variant with Malignant Hyperthermia Susceptibility. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance. -

Congenital multicore myopathy with external ophthalmoplegia Benign:1

Sep 20, 2024

3billion, Medical Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The homozygous variant was found in patients diagnosed with another variant in a different gene, with no symptoms related to the gene containing the homozygous variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs763413580; hg19: chr19-39056201;