rs763413580

Variant names:

• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-C
• rs763413580
• NM_000540.3:c.13244_13264delCCGCGGAGGGCGCTGGAGACG

Your query was ambiguous. Multiple possible variants found:

• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-C
• chr19-38565561-CGAGGGCGCTGGAGACGCCGCG-CGAGGGCGCTGGAGACGCCGCGGAGGGCGCTGGAGACGCCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000540.3(RYR1):​c.13244_13264delCCGCGGAGGGCGCTGGAGACG​(p.Ala4415_Asp4421del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000114 in 1,483,462 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A4415A) has been classified as Likely benign. The gene RYR1 is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.00014 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00011 (0 hom.)
• Consequence: RYR1 NM_000540.3 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:6 B:1
• Conservation: PhyloP100: 4.53
• Publications: 0 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, ClinGen
• RYR1-related myopathy

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for RYR1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	NM_000540.3	MANE Select	c.13244_13264delCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421del	disruptive_inframe_deletion	Exon 91 of 106	NP_000531.2	P21817-1
	RYR1	NM_001042723.2		c.13229_13249delCCGCGGAGGGCGCTGGAGACG	p.Ala4410_Asp4416del	disruptive_inframe_deletion	Exon 90 of 105	NP_001036188.1	P21817-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	ENST00000359596.8	TSL:5 MANE Select	c.13244_13264delCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421del	disruptive_inframe_deletion	Exon 91 of 106	ENSP00000352608.2	P21817-1
	RYR1	ENST00000355481.8	TSL:1	c.13229_13249delCCGCGGAGGGCGCTGGAGACG	p.Ala4410_Asp4416del	disruptive_inframe_deletion	Exon 90 of 105	ENSP00000347667.3	P21817-2
	RYR1	ENST00000594335.6	TSL:1	n.*3954_*3974delCCGCGGAGGGCGCTGGAGACG		non_coding_transcript_exon	Exon 88 of 103	ENSP00000470927.2	M0R014

Frequencies

GnomAD3 genomes AF: 0.000145 AC: 22 AN: 151962 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00116

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000473

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000736

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000152 AC: 13 AN: 85708 AF XY: 0.000144

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000562

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000720

Gnomad FIN exome AF: 0.000405

Gnomad NFE exome AF: 0.0000320

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000110 AC: 147 AN: 1331394 Hom.: 0 AF XY: 0.000116 AC XY: 76 AN XY: 656366

African (AFR) AF: 0.000111 AC: 3 AN: 27018

American (AMR) AF: 0.000136 AC: 4 AN: 29504

Ashkenazi Jewish (ASJ) AF: 0.0000427 AC: 1 AN: 23420

East Asian (EAS) AF: 0.000877 AC: 26 AN: 29650

South Asian (SAS) AF: 0.000190 AC: 14 AN: 73688

European-Finnish (FIN) AF: 0.000908 AC: 30 AN: 33032

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3946

European-Non Finnish (NFE) AF: 0.0000483 AC: 51 AN: 1055698

Other (OTH) AF: 0.000325 AC: 18 AN: 55438

GnomAD4 genome AF: 0.000145 AC: 22 AN: 152068 Hom.: 0 Cov.: 31 AF XY: 0.000175 AC XY: 13 AN XY: 74328

African (AFR) AF: 0.000120 AC: 5 AN: 41524

American (AMR) AF: 0.0000654 AC: 1 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00117 AC: 6 AN: 5144

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.000473 AC: 5 AN: 10574

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000736 AC: 5 AN: 67942

Other (OTH) AF: 0.00 AC: 0 AN: 2108

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.000144

Asia WGS AF: 0.00290 AC: 10 AN: 3466

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	3	-	not provided (3)
-	2	-	RYR1-related disorder (2)
-	-	1	Congenital multicore myopathy with external ophthalmoplegia (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=111/89	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs763413580; hg19: chr19-39056201;