2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant names:

• chr2-203873327-C-CATATATATATATATATATATATATATATATATATATATATAT
• rs60872763
• NM_005214.5:c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_005214.5(CTLA4):​c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene CTLA4 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 0)
• Consequence: CTLA4 NM_005214.5 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.83
• Publications: 3 publications found

Genes affected

CTLA4 (HGNC:2505): (cytotoxic T-lymphocyte associated protein 4) This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]

CTLA4 Gene-Disease associations (from GenCC):

• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for CTLA4 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005214.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTLA4	NM_005214.5	MANE Select	c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT		3_prime_UTR	Exon 4 of 4	NP_005205.2
	CTLA4	NM_001037631.3		c.*567_*608dupATATATATATATATATATATATATATATATATATATATATAT		3_prime_UTR	Exon 3 of 3	NP_001032720.1	P16410-5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTLA4	ENST00000648405.2	MANE Select	c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT		3_prime_UTR	Exon 4 of 4	ENSP00000497102.1	P16410-1
	CTLA4	ENST00000696479.1		c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT		3_prime_UTR	Exon 5 of 5	ENSP00000512655.1	A0A8Q3SIR7
	CTLA4	ENST00000696049.1		c.*515_*516insATATATATATATATATATATATATATATATATATATATATAT		downstream_gene	N/A	ENSP00000512353.1	A0A8Q3WKZ2

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs60872763; hg19: chr2-204738050;