2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_005214.5(CTLA4):c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene CTLA4 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_005214.5 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiencyInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005214.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTLA4 | MANE Select | c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 4 of 4 | NP_005205.2 | ||||
| CTLA4 | c.*567_*608dupATATATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 3 of 3 | NP_001032720.1 | P16410-5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTLA4 | MANE Select | c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 4 of 4 | ENSP00000497102.1 | P16410-1 | |||
| CTLA4 | c.*530_*571dupATATATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 5 of 5 | ENSP00000512655.1 | A0A8Q3SIR7 | ||||
| CTLA4 | c.*515_*516insATATATATATATATATATATATATATATATATATATATATAT | downstream_gene | N/A | ENSP00000512353.1 | A0A8Q3WKZ2 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 exome Cov.: 0
GnomAD4 genome Cov.: 0
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.