2-214752460-C-CTAGCTGAGGATGATTCATTCTTCTCTGGT
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000465.4(BARD1):c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA(p.Ser555fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
BARD1
NM_000465.4 frameshift
NM_000465.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.414
Genes affected
BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-214752460-C-CTAGCTGAGGATGATTCATTCTTCTCTGGT is Pathogenic according to our data. Variant chr2-214752460-C-CTAGCTGAGGATGATTCATTCTTCTCTGGT is described in ClinVar as [Pathogenic]. Clinvar id is 460714.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
BARD1 | NM_000465.4 | c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser555fs | frameshift_variant | 7/11 | ENST00000260947.9 | NP_000456.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BARD1 | ENST00000260947.9 | c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser555fs | frameshift_variant | 7/11 | 1 | NM_000465.4 | ENSP00000260947.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 30
GnomAD4 exome
Cov.:
30
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Familial cancer of breast Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | May 23, 2023 | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Mar 13, 2021 | This variant has not been reported in the literature in individuals with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 460714). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser555Asnfs*15) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at