rs1553616352
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000465.4(BARD1):c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA(p.Ser555AsnfsTer15) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000465.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- BARD1-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000465.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | MANE Select | c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser555AsnfsTer15 | frameshift | Exon 7 of 11 | NP_000456.2 | Q99728-1 | ||
| BARD1 | c.1578_1606dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser536AsnfsTer15 | frameshift | Exon 6 of 10 | NP_001269472.1 | Q99728-2 | |||
| BARD1 | c.282_310dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser104AsnfsTer15 | frameshift | Exon 3 of 7 | NP_001269474.1 | C9IYG1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | TSL:1 MANE Select | c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser555AsnfsTer15 | frameshift | Exon 7 of 11 | ENSP00000260947.4 | Q99728-1 | ||
| BARD1 | TSL:1 | c.1578_1606dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser536AsnfsTer15 | frameshift | Exon 6 of 10 | ENSP00000480470.1 | Q99728-2 | ||
| BARD1 | TSL:1 | c.1227_1255dupACCAGAGAAGAATGAATCATCCTCAGCTA | p.Ser419AsnfsTer15 | frameshift | Exon 7 of 11 | ENSP00000484976.2 | A0A087X2H0 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.