NM_000465.4:c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000465.4(BARD1):c.1635_1663dupACCAGAGAAGAATGAATCATCCTCAGCTA(p.Ser555AsnfsTer15) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000465.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
- familial ovarian cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
- hereditary nonpolyposis colon cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast Pathogenic:2
This variant has not been reported in the literature in individuals with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 460714). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. For these reasons, this variant has been classified as Pathogenic. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser555Asnfs*15) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). -
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at