20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000311.5(PRNP):c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC(p.His61_Pro76del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,572 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P60P) has been classified as Uncertain significance.
Frequency
Consequence
NM_000311.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Gerstmann-Straussler-Scheinker syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Orphanet
- Huntington disease-like 1Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- inherited Creutzfeldt-Jakob diseaseInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- familial Alzheimer-like prion diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- fatal familial insomniaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- PrP systemic amyloidosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000311.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRNP | NM_000311.5 | MANE Select | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | NP_000302.1 | ||
| PRNP | NM_001271561.3 | c.91_138delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.Ser31_Ala46del | conservative_inframe_deletion | Exon 2 of 2 | NP_001258490.1 | |||
| PRNP | NM_001080121.3 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | NP_001073590.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRNP | ENST00000379440.9 | TSL:1 MANE Select | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | ENSP00000368752.4 | ||
| PRNP | ENST00000424424.2 | TSL:1 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | ENSP00000411599.2 | ||
| PRNP | ENST00000430350.2 | TSL:1 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | ENSP00000399376.2 |
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 151572Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000121 AC: 3AN: 248054 AF XY: 0.0000222 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000171 AC: 25AN: 1461484Hom.: 0 AF XY: 0.0000124 AC XY: 9AN XY: 727070 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000132 AC: 2AN: 151572Hom.: 0 Cov.: 32 AF XY: 0.0000270 AC XY: 2AN XY: 74020 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Submissions by phenotype
Huntington disease-like 1 Uncertain:1
This variant, c.180_227del, results in the deletion of 16 amino acid(s) of the PRNP protein (p.Pro76_Gln91del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant has not been reported in the literature in individuals with PRNP-related conditions.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at