rs193922906

Positions:

• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-C
• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-CGGTGGTGGCTGGGGGCAGCCTCAT
• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT
• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT
• chr20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000311.5(PRNP):​c.180_227del​(p.Pro76_Gln91del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,572 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000017 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PRNP NM_000311.5 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.05

Genes affected

PRNP (HGNC:9449): (prion protein (Kanno blood group)) The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000311.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PRNP	NM_000311.5	c.180_227del	p.Pro76_Gln91del	inframe_deletion	2/2	ENST00000379440.9	NP_000302.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PRNP	ENST00000379440.9	c.180_227del	p.Pro76_Gln91del	inframe_deletion	2/2	1	NM_000311.5	ENSP00000368752	P1
PRNP	ENST00000424424.2	c.180_227del	p.Pro76_Gln91del	inframe_deletion	2/2	1		ENSP00000411599	P1
PRNP	ENST00000430350.2	c.180_227del	p.Pro76_Gln91del	inframe_deletion	2/2	1		ENSP00000399376	P1
PRNP	ENST00000457586.2	c.180_227del	p.Pro76_Gln91del	inframe_deletion	2/2	1		ENSP00000415284	P1

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151572 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000295

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000121 AC: 3 AN: 248054 Hom.: 0 AF XY: 0.0000222 AC XY: 3 AN XY: 134918

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000327

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000179

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000171 AC: 25 AN: 1461484 Hom.: 0 AF XY: 0.0000124 AC XY: 9 AN XY: 727070

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000116

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000216

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151572 Hom.: 0 Cov.: 32 AF XY: 0.0000270 AC XY: 2 AN XY: 74020

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000295

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000395 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Huntington disease-like 1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Mar 27, 2019

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant has not been reported in the literature in individuals with PRNP-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.180_227del, results in the deletion of 16 amino acid(s) of the PRNP protein (p.Pro76_Gln91del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922906; hg19: chr20-4680025;