3-195778940-TGTCGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGCCGTGACCTGTGGACACTGAGGAAGC-T

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 2P and 8B. PM4 BS1 BS2

The NM_018406.7(MUC4):c.12496_12639del(p.Ala4166_Asp4213del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0287 in 97,720 control chromosomes in the GnomAD database, including 36 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.029 (36 hom., cov: 35)
  • Exomes 𝑓: 0.053 (41 hom.)
  • Failed GnomAD Quality Control
• Consequence: MUC4 NM_018406.7 inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: -0.00400

Genes affected

MUC4 (HGNC:7514): (mucin 4, cell surface associated) The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist. At least two dozen transcript variants of this gene have been found, although for many of them the full-length transcript has not been determined or they are found only in tumor tissues. This gene contains a region in the coding sequence which has a variable number (>100) of 48 nt tandem repeats. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018406.7.
• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.0287 (2804/97720) while in subpopulation EAS AF= 0.0426 (131/3072). AF 95% confidence interval is 0.0367. There are 36 homozygotes in gnomad4. There are 1419 alleles in male gnomad4 subpopulation. Median coverage is 35. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 36 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MUC4	NM_018406.7	c.12496_12639del	p.Ala4166_Asp4213del	inframe_deletion	2/25	ENST00000463781.8
MUC4	NM_004532.6	c.83-629_83-486del		intron_variant
MUC4	NM_138297.5	c.83-4779_83-4636del		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MUC4	ENST00000463781.8	c.12496_12639del	p.Ala4166_Asp4213del	inframe_deletion	2/25	5	NM_018406.7	A2

Frequencies

GnomAD3 genomes AF: 0.0287 AC: 2802 AN: 97670 Hom.: 36 Cov.: 35

Gnomad AFR AF: 0.0123

Gnomad AMI AF: 0.0409

Gnomad AMR AF: 0.0232

Gnomad ASJ AF: 0.0459

Gnomad EAS AF: 0.0426

Gnomad SAS AF: 0.0202

Gnomad FIN AF: 0.0485

Gnomad MID AF: 0.0174

Gnomad NFE AF: 0.0334

Gnomad OTH AF: 0.0338

GnomAD3 exomes AF: 0.0216 AC: 2638 AN: 121876 Hom.: 0 AF XY: 0.0185 AC XY: 1216 AN XY: 65834

Gnomad AFR exome AF: 0.00976

Gnomad AMR exome AF: 0.00691

Gnomad ASJ exome AF: 0.00601

Gnomad EAS exome AF: 0.0392

Gnomad SAS exome AF: 0.00545

Gnomad FIN exome AF: 0.0668

Gnomad NFE exome AF: 0.0201

Gnomad OTH exome AF: 0.0129

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0526 AC: 67063 AN: 1274252 Hom.: 41 AF XY: 0.0573 AC XY: 36021 AN XY: 628640

Gnomad4 AFR exome AF: 0.0227

Gnomad4 AMR exome AF: 0.0522

Gnomad4 ASJ exome AF: 0.102

Gnomad4 EAS exome AF: 0.230

Gnomad4 SAS exome AF: 0.0667

Gnomad4 FIN exome AF: 0.169

Gnomad4 NFE exome AF: 0.0395

Gnomad4 OTH exome AF: 0.0706

GnomAD4 genome AF: 0.0287 AC: 2804 AN: 97720 Hom.: 36 Cov.: 35 AF XY: 0.0293 AC XY: 1419 AN XY: 48420

Gnomad4 AFR AF: 0.0123

Gnomad4 AMR AF: 0.0231

Gnomad4 ASJ AF: 0.0459

Gnomad4 EAS AF: 0.0426

Gnomad4 SAS AF: 0.0202

Gnomad4 FIN AF: 0.0485

Gnomad4 NFE AF: 0.0334

Gnomad4 OTH AF: 0.0349

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Hepatocellular carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1560294695; hg19: chr3-195505811;