3-63912684-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCA
• rs193922929
• NM_001377405.1:c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001377405.1(ATXN7):​c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln32_Gln39dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.000373 in 144,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00037 (0 hom., cov: 23)
  • Exomes 𝑓: 0.00018 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN7 NM_001377405.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.10
• Publications: 0 publications found

Genes affected

ATXN7 (HGNC:10560): (ataxin 7) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

ATXN7 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia 7

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• spinocerebellar ataxia type 7

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001377405.1
• BS2: High AC in GnomAd4 at 54 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001377405.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	NM_001377405.1	MANE Select	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	NP_001364334.1	O15265-1
	ATXN7	NM_001177387.1		c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 2 of 13	NP_001170858.1	O15265-2
	ATXN7	NM_000333.4		c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	NP_000324.1	O15265-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	ENST00000674280.1	MANE Select	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000501377.1	O15265-1
	ATXN7	ENST00000295900.10	TSL:1	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000295900.6	O15265-1
	ATXN7	ENST00000522345.2	TSL:2	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	Exon 1 of 12	ENSP00000428067.2	O15265-2

Frequencies

GnomAD3 genomes AF: 0.000366 AC: 53 AN: 144616 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.000978

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000204

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000209

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000107

Gnomad OTH AF: 0.000996

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000185 AC: 174 AN: 942420 Hom.: 0 Cov.: 26 AF XY: 0.000177 AC XY: 79 AN XY: 446582

African (AFR) AF: 0.00147 AC: 26 AN: 17712

American (AMR) AF: 0.00 AC: 0 AN: 5282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 8402

East Asian (EAS) AF: 0.000104 AC: 1 AN: 9614

South Asian (SAS) AF: 0.000200 AC: 4 AN: 20022

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 18856

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2096

European-Non Finnish (NFE) AF: 0.000167 AC: 138 AN: 827332

Other (OTH) AF: 0.000151 AC: 5 AN: 33104

GnomAD4 genome AF: 0.000373 AC: 54 AN: 144718 Hom.: 0 Cov.: 23 AF XY: 0.000298 AC XY: 21 AN XY: 70412

African (AFR) AF: 0.00100 AC: 40 AN: 39998

American (AMR) AF: 0.000204 AC: 3 AN: 14702

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3374

East Asian (EAS) AF: 0.000210 AC: 1 AN: 4766

South Asian (SAS) AF: 0.000212 AC: 1 AN: 4708

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8512

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000107 AC: 7 AN: 65440

Other (OTH) AF: 0.000985 AC: 2 AN: 2030

Alfa AF: 0.00 Hom.: 39

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=68/32	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922929; hg19: chr3-63898360;