chr3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chr3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001377405.1(ATXN7):​c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln32_Gln39dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.000373 in 144,718 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00037 (0 hom., cov: 23)
  • Exomes 𝑓: 0.00018 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN7 NM_001377405.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.10

Genes affected

ATXN7 (HGNC:10560): (ataxin 7) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001377405.1
• BS2: High AC in GnomAd4 at 54 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN7	NM_001377405.1	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	3/13	ENST00000674280.1	NP_001364334.1
ATXN7	NM_001177387.1	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	2/13		NP_001170858.1
ATXN7	NM_000333.4	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	3/13		NP_000324.1
ATXN7	NM_001377406.1	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	2/12		NP_001364335.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN7	ENST00000674280.1	c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln32_Gln39dup	disruptive_inframe_insertion	3/13		NM_001377405.1	ENSP00000501377.1

Frequencies

GnomAD3 genomes AF: 0.000366 AC: 53 AN: 144616 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.000978

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000204

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000209

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000107

Gnomad OTH AF: 0.000996

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000185 AC: 174 AN: 942420 Hom.: 0 Cov.: 26 AF XY: 0.000177 AC XY: 79 AN XY: 446582

Gnomad4 AFR exome AF: 0.00147

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000104

Gnomad4 SAS exome AF: 0.000200

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000167

Gnomad4 OTH exome AF: 0.000151

GnomAD4 genome AF: 0.000373 AC: 54 AN: 144718 Hom.: 0 Cov.: 23 AF XY: 0.000298 AC XY: 21 AN XY: 70412

Gnomad4 AFR AF: 0.00100

Gnomad4 AMR AF: 0.000204

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000210

Gnomad4 SAS AF: 0.000212

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000107

Gnomad4 OTH AF: 0.000985

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922929; hg19: chr3-63898360;