3-9890744-CGAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCG-C

Variant names:

• chr3-9890744-CGAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCG-C
• NM_032492.4:c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_032492.4(JAGN1):​c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG​(p.Ala9SerfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: JAGN1 NM_032492.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.41

Genes affected

JAGN1 (HGNC:26926): (jagunal homolog 1) The protein encoded by this gene is a transmembrane protein. It functions in the early secretory pathway and is necessary for neutrophil differentiation and survival. Mutations in this gene result in severe congenital neutropenia. [provided by RefSeq, Oct 2014]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.957 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
JAGN1	NM_032492.4	c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG	p.Ala9SerfsTer9	frameshift_variant	Exon 1 of 2	ENST00000647897.1	NP_115881.3
JAGN1	NM_001363890.1	c.-245_-209delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG		5_prime_UTR_variant	Exon 1 of 2		NP_001350819.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
JAGN1	ENST00000647897.1	c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG	p.Ala9SerfsTer9	frameshift_variant	Exon 1 of 2		NM_032492.4	ENSP00000496942.1
JAGN1	ENST00000489724.2	c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG	p.Ala9SerfsTer9	frameshift_variant	Exon 1 of 2	3		ENSP00000497724.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive severe congenital neutropenia due to JAGN1 deficiency Uncertain:1

Apr 28, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with JAGN1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala9Serfs*9) in the JAGN1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 175 amino acid(s) of the JAGN1 protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-9932428;