chr3-9890744-CGAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_032492.4(JAGN1):​c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG​(p.Ala9SerfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

JAGN1
NM_032492.4 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 8.41
Variant links:
Genes affected
JAGN1 (HGNC:26926): (jagunal homolog 1) The protein encoded by this gene is a transmembrane protein. It functions in the early secretory pathway and is necessary for neutrophil differentiation and survival. Mutations in this gene result in severe congenital neutropenia. [provided by RefSeq, Oct 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.957 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
JAGN1NM_032492.4 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9SerfsTer9 frameshift_variant Exon 1 of 2 ENST00000647897.1 NP_115881.3 Q8N5M9
JAGN1NM_001363890.1 linkc.-245_-209delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG 5_prime_UTR_variant Exon 1 of 2 NP_001350819.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
JAGN1ENST00000647897.1 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9SerfsTer9 frameshift_variant Exon 1 of 2 NM_032492.4 ENSP00000496942.1 Q8N5M9
JAGN1ENST00000489724.2 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9SerfsTer9 frameshift_variant Exon 1 of 2 3 ENSP00000497724.1 A0A3B3ITE9

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Autosomal recessive severe congenital neutropenia due to JAGN1 deficiency Uncertain:1
Apr 28, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with JAGN1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala9Serfs*9) in the JAGN1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 175 amino acid(s) of the JAGN1 protein. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-9932428; API