chr3-9890744-CGAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_032492.4(JAGN1):​c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG​(p.Ala9fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

JAGN1
NM_032492.4 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 8.41
Variant links:
Genes affected
JAGN1 (HGNC:26926): (jagunal homolog 1) The protein encoded by this gene is a transmembrane protein. It functions in the early secretory pathway and is necessary for neutrophil differentiation and survival. Mutations in this gene result in severe congenital neutropenia. [provided by RefSeq, Oct 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.957 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
JAGN1NM_032492.4 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9fs frameshift_variant 1/2 ENST00000647897.1 NP_115881.3 Q8N5M9
JAGN1NM_001363890.1 linkc.-245_-209delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG 5_prime_UTR_variant 1/2 NP_001350819.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
JAGN1ENST00000647897.1 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9fs frameshift_variant 1/2 NM_032492.4 ENSP00000496942.1 Q8N5M9
JAGN1ENST00000489724.2 linkc.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG p.Ala9fs frameshift_variant 1/23 ENSP00000497724.1 A0A3B3ITE9

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Autosomal recessive severe congenital neutropenia due to JAGN1 deficiency Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpApr 28, 2022This sequence change creates a premature translational stop signal (p.Ala9Serfs*9) in the JAGN1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 175 amino acid(s) of the JAGN1 protein. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with JAGN1-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-9932428; API