NM_032492.4:c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_032492.4(JAGN1):c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG(p.Ala9SerfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_032492.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
JAGN1 | NM_032492.4 | c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG | p.Ala9SerfsTer9 | frameshift_variant | Exon 1 of 2 | ENST00000647897.1 | NP_115881.3 | |
JAGN1 | NM_001363890.1 | c.-245_-209delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG | 5_prime_UTR_variant | Exon 1 of 2 | NP_001350819.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
JAGN1 | ENST00000647897.1 | c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG | p.Ala9SerfsTer9 | frameshift_variant | Exon 1 of 2 | NM_032492.4 | ENSP00000496942.1 | |||
JAGN1 | ENST00000489724.2 | c.24_60delAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGG | p.Ala9SerfsTer9 | frameshift_variant | Exon 1 of 2 | 3 | ENSP00000497724.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive severe congenital neutropenia due to JAGN1 deficiency Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with JAGN1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala9Serfs*9) in the JAGN1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 175 amino acid(s) of the JAGN1 protein. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.