4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5

The NM_000222.3(KIT):​c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG​(p.Lys550_Lys558del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

KIT
NM_000222.3 conservative_inframe_deletion, splice_region

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.73

Publications

5 publications found
Variant links:
Genes affected
KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]
KIT Gene-Disease associations (from GenCC):
  • gastrointestinal stromal tumor
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Ambry Genetics
  • piebaldism
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • cutaneous mastocytosis
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • mastocytosis
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

PM1
In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 11 uncertain in NM_000222.3
PM4
Nonframeshift variant in NON repetitive region in NM_000222.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is Pathogenic according to our data. Variant chr4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 13857.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KITNM_000222.3 linkc.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG p.Lys550_Lys558del conservative_inframe_deletion, splice_region_variant Exon 11 of 21 ENST00000288135.6 NP_000213.1 P10721-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KITENST00000288135.6 linkc.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG p.Lys550_Lys558del conservative_inframe_deletion, splice_region_variant Exon 11 of 21 1 NM_000222.3 ENSP00000288135.6 P10721-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Gastrointestinal stromal tumor Pathogenic:1
Jun 16, 2005
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.7
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs121913234; hg19: chr4-55593579; COSMIC: COSV55392408; API