rs121913234

Variant names:

• chr4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C
• rs121913234
• NM_000222.3:c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000222.3(KIT):​c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG​(p.Lys550_Lys558del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KIT NM_000222.3 conservative_inframe_deletion, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.73
• Publications: 5 publications found

Genes affected

KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]

KIT Gene-Disease associations (from GenCC):

• gastrointestinal stromal tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)
• piebaldism

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• cutaneous mastocytosis

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• mastocytosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 34 uncertain in NM_000222.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000222.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is Pathogenic according to our data. Variant chr4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 13857.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000222.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIT	NM_000222.3	MANE Select	c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG	p.Lys550_Lys558del	conservative_inframe_deletion splice_region	Exon 11 of 21	NP_000213.1	P10721-1
	KIT	NM_001385284.1		c.1651_1677delAAACCCATGTATGAAGTACAGTGGAAG	p.Lys551_Lys559del	conservative_inframe_deletion splice_region	Exon 11 of 21	NP_001372213.1	A0A8I5KS03
	KIT	NM_001385290.1		c.1651_1677delAAACCCATGTATGAAGTACAGTGGAAG	p.Lys551_Lys559del	conservative_inframe_deletion splice_region	Exon 11 of 21	NP_001372219.1	A0A8I5QKP7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIT	ENST00000288135.6	TSL:1 MANE Select	c.1648-2_1672delAGAAACCCATGTATGAAGTACAGTGGA	p.Lys550fs	frameshift splice_acceptor splice_region intron	Exon 11 of 21	ENSP00000288135.6	P10721-1
	KIT	ENST00000412167.7	TSL:1	c.1639-2_1663delAGAAACCCATGTATGAAGTACAGTGGA	p.Lys547fs	frameshift splice_acceptor splice_region intron	Exon 11 of 21	ENSP00000390987.3	A0A8J8Z860
	KIT	ENST00000687109.1		c.1651-2_1675delAGAAACCCATGTATGAAGTACAGTGGA	p.Lys551fs	frameshift splice_acceptor splice_region intron	Exon 11 of 21	ENSP00000509371.1	A0A8I5KS03

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Gastrointestinal stromal tumor (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121913234; hg19: chr4-55593579; COSMIC: COSV55392408;