NM_000222.3:c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG

Variant names:

• chr4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C
• rs121913234
• NM_000222.3:c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000222.3(KIT):​c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG​(p.Lys550_Lys558del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KIT NM_000222.3 conservative_inframe_deletion, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.73
• Publications: 5 publications found

Genes affected

KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]

KIT Gene-Disease associations (from GenCC):

• gastrointestinal stromal tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Ambry Genetics
• piebaldism

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• cutaneous mastocytosis

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• mastocytosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 11 uncertain in NM_000222.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000222.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is Pathogenic according to our data. Variant chr4-54727413-CAGAAACCCATGTATGAAGTACAGTGGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 13857.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KIT	NM_000222.3	c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG	p.Lys550_Lys558del	conservative_inframe_deletion, splice_region_variant	Exon 11 of 21	ENST00000288135.6	NP_000213.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KIT	ENST00000288135.6	c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG	p.Lys550_Lys558del	conservative_inframe_deletion, splice_region_variant	Exon 11 of 21	1	NM_000222.3	ENSP00000288135.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Gastrointestinal stromal tumor Pathogenic:1

Jun 16, 2005

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121913234; hg19: chr4-55593579; COSMIC: COSV55392408;